GenePrediction:GLEAN_1141 Details

Name: GLEAN_1141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:822092..824094 (+ strand)
Length: 2003
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:822092..822223 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_173:822283..823688 (+ strand)
Length: 1406
Type: CDS
Source: GLEAN
Position: GCSC_173:823809..824094 (+ strand)
Length: 286
>GLEAN_1141 class=GenePrediction position=GCSC_173:822092..824094 (+ strand)
ATGGATATCCGCACTTCGAAAGCCCAGCTGACCTACCCGCTTTATGCCTGCGACTTTGACGCGCAGGATGCCGGCCGCCT
TGTTGTCGGTGGAGGTGGCGGCTCCAGTCGTACGGGAGTGGGAAACTGCATTGTAAGAGAGAGAGAGAAGACGTGCATAT
AAAGCAGGACGTCACGGCTGATCACAAACAGACAGTGCTCGATTCCTCGTCCGCCAGCAATAGCAGCCTCGCCACAGTCG
CCGAGATCGAGCTCTCCAAGGACGAAGACAACGTGACGAGCCTGGCTGCAGGGCCTCGATTTGGCCAAACGACGCTCGCC
TTTGCTGGTGTGAACTCGAGTCCGGCGGACCAGAAGAAGGGCAAGAACGAGCACTTCCGCGTGTTTAGCATTGACACAAA
TGTCCCGGCTGCAGCTGCCGAGGACGCCAACACCCCCGGGAACATCACCGAGCTGGCACACGCCTCGTTCTTTGCACCCT
TGCCGGCCGAGCATGCCAACCTTCCCGACGACACATACCAGCGCCTTGTGCGCTTGTCGGCGCCCTTTTCCGACGGCCAC
GGCAGCACCCTGCCCCAGTTGGGCGCCTGTGCCACAGGCCTGGCCCGTGCCGGCACCTCGCAGATCGTGCTGTTCGACGT
GGCTCCGGCAGCGTCCGGCTCGACGCCCAGCTCGGCGCTGCCACACGTGCGCTGTCGCATCGAGCAGCTGCCCAAGGAGG
CCACCGACCTGGATGTCGTCCAGACGGACGTCGATCGGTACCAGCTGGCCTTTTGCAACGAGCACGAGCTGTTCCTGTAC
GACGTGGCGGCCAAGGACGGCGGCAGCGAGAAGCCCGTCCTGGCCTATACCATTCCGCTGGACGTGGCCAGCGGTGCCAC
CGAGCGGCCGGTCTTCCGTGCCCTCCGCTACGTGACGCCACAGTTTGTGCTCGTGGCCCTCAACATGCCCAGACGCACGG
GTGTACGGCTGATGGGCCTGCGACTACCAAACAGCCTCCCGGCCAGCGCGCCTGTCAGCGAGAGGAGCGGCAAGGCGAAG
CCCGTCAACATTGCCCGCACGACCACCGTGCACATTGCCGTCCCGCGGTCGATCCTGACCCAGGCGACGGCGCTGACCGT
GCGCGGCCTAACACAGCCGGCGACACCTGGTGGACGCCTGGGCGACGCCCAGTTCGTTGTCGCTGTCGCCGGCGCGCCCG
ATAACACTATCGCGCTGTACACGCTCGAGCAGCAGGTTGTCGGGTCCGTCGAGGCGCTGGCGAAGCTGTATCCGTTTCGG
ACCCTGCGCCAGGTGCACGAGCTGCAGATGACGAGCTTGGCCCTGTCGCCGTTTGTCCCGCCGTCTGCTCCAACTGCTTC
GGCCACCTCTTCGCCTTCGGCCTTCATCCGCCTGGCCAGCGTGTCCGTCAAGAACACCGTCGTCGTGCACCACATCCCGC
TGCGGACGCTGCCGGGAACCGCCGCGCCGTCGCGCTACGTGGTGGCGCTCAAGTCGCGAGGCCCGTCCGGCATGTCGCTG
TACATCTTCATGGCTGTCGTGATCGTCCTGATTGGCGTTGTGTCACAGAGCCTGCTCGAGATCCGCGGGGCCGCACCGTC
TGTGCTGGGCGCACGCCAGCTGTCGCCCACCTCGTGGCTGCGACCCGAGAAGATTATCGCCAGCAGCAGCAGTAGCAGCA
GCAGCCAGTCGCCCATCATCGACAATGACGGCATCAGCGTGGCCTCTCTGCTGCGCGGCGACGTCGCCCACGACGACGAC
GTCGCGCCACCCGTGCTCTTCTTGCGCGGCGAGGACGCCGACCACACCATCGAGGTGGTCACGCACAGCGAGGCTGAACA
CGGCCCGGCCGTCGCCTGGGACGGCCTCACGCCCGCACAGCAGTCTGCCTGGCGGCAGCGGCTGCAGGACGCCGGACACT
GGGGCCAGGACATGGGCGAGACCGTCTTCCGGGGTGTGCTGTTCAGCGAGCTCGCCGGGGTCGTCGGCGAGATGGTGAGA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62