GenePrediction:GLEAN_1143 Details

Name: GLEAN_1143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:838820..839557 (+ strand)
Length: 738
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:838820..839062 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_173:839321..839557 (+ strand)
Length: 237
>GLEAN_1143 class=GenePrediction position=GCSC_173:838820..839557 (+ strand)
ATGCGTTACGCTGCTGCTGCCGTCTTTTTCGCCGGTGCCGCTCTGGCCGGCACCGAGGCTCCTGAGAGCACCATCTACAG
CACGGACTTCGTCACGATCACGTCCTGCGCTCCGGAAGTTACCAACTGCCCGGCCCGGACTCACAGCACCGTCTACCCGG
TCACGTCCTCGACGGTCTACTCGACCAACGTGTACGCCACGACCAGCGCCGGCACCGTTGGCTACTCCACCGAGAGCATC
CCGGTCTCTGCCACCCTTGTCCCCATCGCCTCGACCGGCAAGTCCTACTACAACACCACCGTCGCAACCAACGGCCCCAC
CGCCGTTCTTGGCGTCGTTGTCTCCACCCCCGTCGCTGTTCCTACCACCGTCACCTCGGCTGCTGCCGTCGGCACCCCGG
GTGTCCCGGCCGTTGACACCACCACTGGTGTCGCTGCTGTTGGCACTACGCCCGCTGCCGTTGTCGGCACTGCTGGTGCT
TGCGGCTCTTACTCCGTCAAGACCATCTCGACCTCTGTGACGACTGTCGTCCCGACTGTCATCTACGAGACCGTCTCGGT
CGCCTGCCCCACTGGTGCTAACACCCCCGTCGGCACCCTCGGCACCGTCGGTGTTGCTACGCCCACTGGCAAGAGCCCCG
TCCCGTCGTCCAGCATCGTCACTGCTGGTGCCGGCAACGTTGCTTTCTCCGGTGTCCTGGCCGCCGCTGCCGGCCTTGTC
GCTGTCTTCCTCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62