GenePrediction:GLEAN_1144 Details

Name: GLEAN_1144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:853215..854134 (+ strand)
Length: 920
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:853215..853316 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:853403..853432 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_173:853572..853722 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_173:853842..854020 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_173:854102..854134 (+ strand)
Length: 33
>GLEAN_1144 class=GenePrediction position=GCSC_173:853215..854134 (+ strand)
ATGAACTCTCTTCGCATTGCCCGCGCTGCCCTGCGCGTGCGCCCGGCCGTGGCCCGTATGGCTGTTCAGCGGAGAACCTA
CGCCGATGCCGTTCCGGACAAGGTATGCAACTCCGGAGCTTCTGGAAAAGACGCAAGCACCCCTTCTCCGGGACGCGATC
TCGGCTAACTATGCTCGACCCAATTCAGATCAACCTGAGCCTGTCTCTGCCTCACCAGGTACGAATTGATGTTTCTCTTC
CGTCGAACGGAACGATGCGCGATAATCCGTTCCTCCGAGCCCGTTTTCGTTATCACAACAATGCCCAGTAATCGCAGTCC
GTGACGTGAAAGCTAATTCGATGCTCTCTTCGTACAGTCCATCTACAAGTCGCAGGATGTCGTGCAGGTCAACATCCCGG
CCGAGTCGGGCGACATGGGTGTCCTGGCCAACCACGTGCCGTCGATCGAGCAGCTGAAGCCCGGCGTGCTGGAGATCATT
GAGGAGAGCGGCAGCAAGCAGTACTTCTGTAAGCAGAAGAAGATGACCGGCGGCCTTCCCAGAGCGTCCCAAAGAGCTTC
AGAGAGGAGCGAGGGGAAGGGTCCGAATTTTATAGAGGGGCTTCCAGGCTAACTTGCACGTGTGCAGTGTCCGGTGGTTT
CGCCGTCGTTCAGCCCAACTCTCACCTGAGCATCAACGCTGTCGAGGGCTACCCCCTGGAGGACTTCAGCGTCGATGCGG
TCAAGTCGCAGCTGGCTGAGGCGCAGAAGGTTGCCAGCGGCAGCGGCAGCGAACGCGAGATCGCTGAGGCCAAGATTGAG
ATTGAGGTAGGTAACATCAGCTAGCTGTCTGGCTGGTCCGCACGCTTCCTATGCCAAGTTCGCTGTGCTGACATTCGCGC
TATACAGGTTCTTGAGTCTCTCCAGGCCGTTCTGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62