GenePrediction:GLEAN_1146 Details

Name: GLEAN_1146
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:860652..861774 (+ strand)
Length: 1123
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:860652..861297 (+ strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_173:861410..861774 (+ strand)
Length: 365
>GLEAN_1146 class=GenePrediction position=GCSC_173:860652..861774 (+ strand)
ATGGACGGAGCACTTCTTTCCGGCTGGCTTGCGTCAGTAGGAGATCAAGCAGCTCGTGTGACGCCAGTCCAGTATTGCCA
AACCGTCTTCGTAATTCTGGCCACTGGTGTCTTGGCTGTGAATGCGTTACCGGCTCGCACAAAACGATACCTGCTTGATT
ATGGAGCACGAGAGAACAAGAGTACTGGTGTGCTTCATGACAAGACCATCGGCAATGCTGGCGGTGACGCTGCCAAACAT
CCGATCGGTGCAGACACCCTGGAATATGTAGTGGCCACGTTTGCTTCATACAGTCAGGTGCCACATGCCTGGTTTTCCAG
TTTTTATATTGCATATCTTGTGTGCGCGTTTGGCTGGACAGCACAATGGTTGCTGTGGCAGCAGGGTGCATCGTCAGGCG
GTTTCTTCGCCTGGCTTGCCGAACACCAGCGGACGGCCGACCGGAAGTCAGAGCCGTCGGCAACATCCATGTCTCTCATG
CAGGTGTCCGTGGCCATGGGGCTAGAAGCTCTACAAGCTGCGCGCCGCCTTTACGAACATGCATCGGTGTTTAAGGCATC
CAATTCAAAGATGAACTTTACACACTGGGCGCTCGGACTGGCGTTTTATGTCTGCATGAGCGTGGCTGTGTGGATCGAAG
GGTCGCGTTCGTATCCCCCTTCATATTTCGTCTCTTTTCAGGCCATTCCTAATCCTCTCTGCTGCAGAAGCAATACTTGC
TACCAGAGACCAGCCCCCCTTCTCACCACACGCTTCAGCCGCAGGCCGAGGCATCGAGTGGGCCAAACTCGCTCTTGGCA
CATCTCTTTTCTTATTCGCCTGGCTGCAGCAGTACCGCTGTCATGGCCACCTTGCTAGCCTGGTAAAGTACTCTTTGCCG
GAAGAGGGTATGTTCCGCTATCTTGTATGCCCTCACTATACCTGCGAGTGCACCCTTTATTTGGCTCTCTCCATCGTTGC
CGCACCAGCTGGCCAGCTGTTCAATCAGACGCTTCTGCCATCGGTGTTCTTTGTGGTTGCGTGCCTCGGCGTGACGGCAA
ACCGGACGACGAAGTGGTATATTGAAAAATTTGGTGCCGCCCGGGTTGCCAAGAGGTGGAAGATGATCCCGTTCATCTTT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62