GenePrediction:GLEAN_1148 Details

Name: GLEAN_1148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:864340..869388 (+ strand)
Length: 5049
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:864340..868737 (+ strand)
Length: 4398
Type: CDS
Source: GLEAN
Position: GCSC_173:868795..869388 (+ strand)
Length: 594
>GLEAN_1148 class=GenePrediction position=GCSC_173:864340..869388 (+ strand)
ATGGATGCGCAGAATGCCACCGCGGCCGCCTCCATGAAGCCTATTGCTTCTTCCATCTCGGACTCCTTGTCATCGCGTAA
CGTCTCTGAGTCTGATCGGGCAAAGGTGGCTTCCTCCACTTTGGCCAAGGCCTCCGGTAGTTCTCGGCTACCGACCGCTC
ACTCGAAGGATGCGAGGCTTTCTTTATCCAGGCCACCGCCACTGCCAGCATCAGCGACGCCTTCGCAATTGCAGTCGTCC
AAAGAACTCCCTTCCAAAGAGGCCCCCAAAAGTCCTGCTACCATCACAGCCGCGTCGTCGTCCTTTAGAGGGGATGCATC
TAGCACTGCGTCTCGCGAGAAACAAGACGAGGAGGGGGGCGGCACAGATGGAAACTCGGAGGCGGAGACGATTGTTTTGT
CAAAGGACGGATCACCAGCGAAGCCTCGAAACCGCAAAGTAATCAAACACGAGGACAAGCGAAATGGAGACTGTGGCTCG
TCTATCTCCGCCCACGACGACCAGTCCGTCCCCACACGCAAGCATAATTCTGACAGAAAGGAGAACCCGTCTGTCAAGGT
CGAAAAGGCACTCCCCACCACAACGATCGGCGATGAAAAAGGCGCGTCTACTGAAGGAGGACTTGCTCCGTCTTCGTCTT
TGCTGCAAAAAAAGAAATGCTTGCAGGAAAAACAACTCCAAAGCGGTCATCACCAGTTGCTGCCAGGGGCTAAGCGCGCC
TCTAGCAGCCTAAGCTCTGCGCCTGCTTCTCCGCCACACAGCCGTCAGCCCTCGACGAACCCCCATTCCGAATCCGACTC
GGACCGTCGGGCTGCCAAGTCACCAATGCTTTTACTGCCCCCATCTAAAGACAAGCTGCGACCCACCGAGAAGCTCATAC
CCAACAAGAGAAAGGCCCCCAAGGCCGAATCGGAGGATGAGGCCGAAAACCGAAAGGCCCGTCGTCAGCGATTAAACGGC
GCCAGCGAAGGTGACAGCACCCCTCACACTGGCAAAGTGATGAAAAGCCAGCTGCATCACGGTGGCCACAACGGCAACAC
CAAGCCACCAACACCCCGTCCGCAGAGGGAGCCATCACGCAACAGGTCCATCTCTCCTCAACGGAGGGTGCATCACCGCA
GCCTTTCCACCCAACTCCCGTCTCAGTCTAACGGACTGAGCTCGAAGAAGAAGCGCCCTACTCCTTTGCAGTCTACCGAT
TACCACTCGGATGAGTCTTCGGCAAGCGCAGGGCCCCACATTCGCAGTTCCAAACCGCGCAGTCTTACGACTCCCGCTAC
AGCTGATTCGACCATGTCCCCAGCCAAAATCGGACCGCACAAAAAGCACCTCGACGCACACGGGCAGACCTTCCTTGCCC
GGGCCTGTGCCCGGGGCGAGTACGACCTCGCAAAGCAGCGTTTGGCTGAACGGCCCGAGGACTTGAACGTCGCCGACTTC
GCTGGAAATACGCCTCTCCAGATTGCTGCACTTAACGGTTACGGTGATATTGTGAAGCTGCTGATCGACGCCGGGTGCAA
TCTAGATTGCGTCAACCATGACAAAGACACTCCTCTCCTGGACGCAGTTGATAATGGACATCTTGAAGTTGTCAAGTTGC
TTCTCGATGCTGGCGTCAGCCCCAGAAAAGCAAATGTTCATGGCGAAGAGCCGTTAGACCGGGTAAGCGATGACATTGAA
AACTCTACCGAGATACGAGCAGCTTTGGTGAGCGCAAGGAAGAGGGAAGGGGAACGAAGGCACACGTCGGAAGAGAACCG
CCATGAGCACGACGAGCCTCGGCTCTCACACGGGCCTGACAGCCCTCGGAGATCGCCTGCACCGTCTTCAAGCCTCCACT
CAGTGGCTATCAGCCGCAGAGCCGGGACCGCGCGAGCAACGAAAACAAGCAACCACCTGCTGTATATGCCTATGGACGAC
AAGACCTTGCGCTTGGCAGCCGGCCGGGGTGACGAAGAGACAGTCACACGGATTCTTCAGGTGCGCGAGGCCTTTGACGA
CCCGGAGTCTATGGTTGCTGCGGCGCGTGGTGGCCATGATATTGTCATGCAACTCCTCCTTGCTCTTGGCCGTGCCAATC
CGGATCCGGAACCGATAGCTTCAGTACCTGCCGAACATGCGACGCCGATGCTTGCTGCCATCGGACAAGAAAACCTTAAG
GTGGTCAACCTCCTTCTGGAGCAGAACAGCTTCGATCCTACGAGAAGATTTCACGGAAGTGCCTATTACGAAATCGCACG
GCAACGGGCCGGGCCAAATTGGAAGGAAGAAGAAGACCTCCTGAAAGCCGCCTATGACAACTTCAAGAAAGGACATGTCG
GCAAGGATGGAAAGCTCAGATCTCCTGTCCGTAAAGATGTGGAGCCAAGGAGGGTTGTGCGTCTCGACCCTAGCGAGGAG
TTGTCTCGTGCACACAAGCGCAAGCTTTCGAGCCCATCGCAAGACAGAGGCAAAAAGGTCAGCGCCAAATCAACCATCTC
AGCTACCTCGACAAGTCCACAGGAAGAACGACCATTGCCGAAGCGGTCAGAGCACTCCGGATCACAAGCGGACGGAAGAT
CATCACCAAAGCGCTCAGGGGCCGGCTCGGTTCCGACGGGGAAGCACAGGCGTGATGACCGCAGTTCCGCTGTACCGGGC
CCCGACCGCGATACTCCAACACTCCATCTGAAGCACGTCAAGTCCAAGAAGACGGACCAGGAGGTGGTAGCGATTTCGTC
GGAAGGCGAGACTGTCAAGCCACGGAGAAAGCTAATCTCCGGAAGAGAACTGAAAGACGAAAAGGAAAAGCAAAGGCGTG
CAAGTCTGGCCTCGACAAACACGGCTCCGTCAAAGGAATCGACCAGCCCGCGTGAGTCACGCTCCGAAGACAACGCAGCA
GACAAGGCCCGAGCCGAGAAACATCGCGATCGCGACCGCGACCGTGCACGACAGCTCAAGAGCGAAGAGTCTAGGGAATC
ACTGTCTGGTACGGACGGAGGCTTAGCTAAACGCTACCGCATGAGTGAAACCCCTTCGTCAGACAAAGATGCCGTCGAAG
GCCCTATTAAGAAAAGGAAGCTTGACGGCGACGGCGCCAGCATCAGTGGGAAGGAGAGGAAGGTTTCCAAAGTTAATGGA
CCGTCGGACGATGCTATCATCAGGTCAATTCCTAGTTCCTCATCGCGCGACACACCGAAGAGCGTCTCGAAGCGGCGCGA
CGACGACGACCGCAAAGGATTGCCGTCCTTGTTGAAGACAAAGAAGCGGGACTCGTCATCTGATCGTGGCCGGAAGAGCT
CGACAAAGCTACTGGCTAACGAGAAGAGCATTCACGTCAAATCTGAAGATACAGATATCGAAATGACGGATGCCGGCAGC
GAAGTGCGCGCCTCCGGCGGTTCGGACGCAGTCCGAACAAATAGCGAGATCCGGGTTCTGCAACGAGCGAGGGATGATGA
GAGGAAGGCAGCTCAAGCGGAAATCCAAGTTGCTGAGGTGTCAAGGAAGAAGGAGGAAGAGGCGAAGCGCCTTCGCCAGG
AAGAAGAGGGGAAGCGCAAAAGGGAAGAGGACGACAGACGGAAGAGAGAAGATGAGAGGTGTAAGCGGGAGGAAGAGAGC
AAGCGGAAGGAGGAAGAGGTGCGAAAGAAGAGAGAGGAGGAAGAAAGGAACGAGAGAGAGCGCAAGAGGGTAGAAGACGA
GGAGCGGAAGCGCAAGGAGGAAGAACGGAAGCGAAAGGAAGAGGTCGAACGGAAACGACGAGAGGACGAAGAGAAGCGGA
AGCGCGCAGAGGAAGAGCGGCTGCGCCAAGAACAAGTGGCAAAGGAAGCAGCGGAAGAAGCTCGCCGGAAACGAGAAGAT
GACGAGCGCAAGGAGCGCGAACGCCAAGAGCGCGACCGGAAAGAGAGGGAACGAGTCCGCGCAGAGCGAGAAGCAGAGGA
AGTGCACCGACGCCAAGTCGAGGAGGAGGAACGTGTCAGGATCTCCAAGCTTCCGGCACTGCTGCAGTGGCTCTGCCAAA
GCACAAACTGCCGTTCGTCGACGACTGCGCACAAGTTCCGCATGATGCAGGGCGTCCGCTACGACTGCATCAATCCGAGC
GCGACCGGGGCGGCGATCGGGCGGGAGCAGTGGCTACTGAACACGCAGGCAGCCCTGATTCTCGGGGACAAGGACCTGAG
CCTGGCCAAGTACCCGTCGTGGCAGCACGCCCCGGTGTCGATCATTGCGAAGCGGATCATCTGGCGCCTCGAAACGGACC
GGTATGCGTTGACGGAGCCGGATTTGTATGATTTGGGCAAGCAGCTGCCCGACTACTACGAGGGATCGGATCCGGACACG
ATGAGCTACCAGGTGGTCGAGAGGCTCCGTGGCGAAGCTTGGGAAAAGTTTTCTGCCACGGACATGTTCTTTGTCAAGGT
TTGTCTCGCTCTCGTGTGGCCGAAGACCGGACGCTGTGCTAACCTCAACTCACAGGCTTCTGATGTGATGAGCATCGTCC
CGAACTTCCCCCATCTGCGCGACGTCCGGCTCGTCATGGCTTACCGAGAGTTGCCCGAAGACGAGGCGCAGCTGTCGACA
TTCAAGGTGACGCAGAAGTGGAAGAACGATCCGGATGGAGATCGGTTTTACGGATTCGCACCACGGAACAAATACTACAT
TAATGGGCAGATGGTCAAGGAGGAACGGCCGGGCTTCAGTGCCGTCAGCAAGACGCCTTTTCCCGAGGTCCGTGTGCCAC
GTCGTCGTGGGATTGTTGCAGTGTCTGTCGACGACCCGGACTACAGGCGTCTGTGCAAGGAACAGGGCATTGAGCCGGTG
GCCATGGCCTCTGATGCTCAGTCGCCGGTGCACACAACTGGCGTCGCCCTCTCCCCCAAGTCAGTGGCGGCCAAGACCAA
CGGCAAGACGGCGCACTCACAAGATGGTCTGAACGGCGACACTGTTGATCTTATGCAGACCAGCCCTCTTTCGACGGCAC
AGAAGACACCTCGCCAAGTCAACGGTATTAATGGCACCAACGGCACCAACGGCACCAATGGCATCAATGGCATCAATGGG
CACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62