GenePrediction:GLEAN_1149 Details

Name: GLEAN_1149
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:870282..871686 (+ strand)
Length: 1405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:870282..870302 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_173:870372..870392 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_173:870462..871382 (+ strand)
Length: 921
Type: CDS
Source: GLEAN
Position: GCSC_173:871480..871600 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_173:871667..871686 (+ strand)
Length: 20
>GLEAN_1149 class=GenePrediction position=GCSC_173:870282..871686 (+ strand)
ATGTCGACGACCGTGGAGAAGGTATGTTGAAGGGCTGGTCTTGGTGTCGAAGTGTGCGTGGACGACTGCTAACCCGATGG
TGGCTGCTAGATTAAAGAGGTCGAGGCCGAGGTATGTTGCAGCCCATCCAGCGACAGGTGTGCTCTGGCTTGTGTCCGAG
GCTAACAGGACGGTGTGTAGATGGCCCGGACGCAAAAAAACAAGGCGACGTCGTACCATTTGGGACAGCTCAAGGCGAAG
CTCGCAAAGCTCAAGCGCGAGCTGCTGATGCCGACGAGCGGTGGCGGTGGTGGCGGGACGGGCTTTGACGTGGCGCGGAC
GGGCGTGGCCAGCATCGGTTTCATCGGGTTCCCGTCGGTGGGCAAGAGCACGCTGATGAGCCTGCTGACGGGCCAGCACT
CGGAGGCAGCCGCATACGAGTTCACGACGCTGACGAGCGTGCCGGGCCAGGTGACGTACAACGGGGCGCCGTTGCAGATG
ATTGATCTGCCCGGCATCATCGAGGGTGCCAAGGACGGCCGAGGCCGAGGTCGACAGGTGATTGCGGTAGCCAAGACGTG
CAACCTGATCTTCATCGTGCTGGACGTCAACAAGCCGCTGACGGACAAGCGGGTGATCGAGAACGAGCTCGAGGGCTTCG
GCGTGCGCATCAACAAGCAGCCGCCCAACATCACGTTCCGCAAGAAGGACAAGGGCGGCCTCAACATCACGAGCACGATG
CCGCTGACGCACATTGACCACGACGAGATCCGCGCCGTCATGAGCGAGTATCGCATCAACTCGGCCGACATTGCCATCCG
CTGCGACGCTACTGTCGACGACCTGATCGACGTGCTCGAGGCCCGCAGTCGCAGCTATATCCCGGTCATCTACGTGCTCA
ACAAGATCGACGCCATCACCATCGAGGAGCTCGACCTGCTGTACCGCATCCCACATGCCGTGCCCATCAGCTCCGAGCAC
GGCTGGAACATTGACGAGCTGATGGAGGCCATGTGGGAGAAGCTCAGCCTCGTCCGCGTCTACACCAAGCCCAAGGGACG
GCTGCCCGACTACACGGCGCCCGTGGTTTTGCGGTCCGGCAAATGCACCGTGGAGGATTTCGTGAGTTTTTCTTTCTTTC
TTTCTTTCTTTTCTTTTTTTTCTTTTTTCTCTTTCTTCTTTTTTTCCTTTCACGCTCTGTCTTGTCTAATACATCTAGTG
TAATGCCATCCATCGGAGCATCCTGGAGCAGTTCAAGTCGGCCATCGTGTACGGGAAATCGGTCAAGCATCAGCCACAAC
GGGTTGGCCTGGCACACGTGCTGGAAGACGAGGACATTGGTATGTCTGCTGAGCGCATTGCATACCATGACTATATGTGG
AAGAGTGCTGACCTAGGACAACTAGTCACGATCGTCAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62