GenePrediction:GLEAN_1150 Details

Name: GLEAN_1150
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:879840..881674 (+ strand)
Length: 1835
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:879840..880207 (+ strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_173:880271..880646 (+ strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_173:880694..881674 (+ strand)
Length: 981
>GLEAN_1150 class=GenePrediction position=GCSC_173:879840..881674 (+ strand)
ATGTCGGACCATCAGAACCATCATCAGCAGGAGGTGCCGATTATAGCACAACCGGTACCACACCACCATCACCTTCCCCA
GCTCCCGATGCTGATGGTGCCGTCAAATCCAACGTGGCCGAGCATGCTTACAAATCCCGGCGGAAACTACCCTTCCACGG
CGCCGTCGACCATTAGTAGTGCAAGCCACGGACGGCAATCGATCGGCATCCCCGTCCGCAGGGCGATGAAGCCGAACGAG
AAGGAGGGAAAGCCGACCCCGCGGAGGATGCTGACGGACGATGACCGCCGGAGAATGTGCAAATATGCCGACATGAACCC
GGGTGTCAAGCAGTCCGACATTGGAAACCTGTTTGGGGTAGAAAGAAGGTAGGGCTCAGCTCATATTCCTTTGTCGCAGT
AGGACACACCATTTACAAGATGCTATTTTAGTACCGTGTCAAAGGTTCTTCGCAACAAGGAAAAGTACTTCAACAAGGAA
GACCGGAGCAAGTCGCCACACAAGAAGGCCAAAGGCAAGCTTCCTGATATCGAACGAGCGCTCTCGAACTGGGTACGCAA
TGCACAGAAGACTGGGACACCAATGACGGACGACGCAATCCAAGAAAAATTTCGATTCTTTGCAACAAGCACGGGAAACC
CAGACACCGTCCTCAAAGCCAGCAGCAGCAGCTGGCTGGAGAAGTTCAAGCAGAAGAACGGAATAGGGGCAGGAAGGCTT
TTGCGCCGTGCTTCCGAGACAAACATCCCGGACCGTCGTCTAGACGCAGCTGTTGCAAGAGCGATAGAATCCCCATCTCT
GACACCAGTAAATCCTAACCCAACGCTAGATCACCGTCCTCGCCGGCATGTCAGCCGTCACCCTCGCCCTTGTCAGCAAG
CCGCAGCGATGACGAGAGGGAGGCGGTCAGCACCGGAGCAGCAGCCGGAAACTACCTCGGCTTTTCACAAGACTCGAGTC
CGAACACTGGCCACGCCGGGCATAGCGGGATGGGACTGGGTAGCGGCCTGACGATGGGACTGGGGATGGCGGTGGGTTCA
TACAAACACGGCAACAACCAGAGCACGACGTCACTGTCGAGCGTCTTTACGGAGACACCTGTGTCGTCCTTCTCTGGAGG
AGCCATGAGCCCGACCATGTCATTTACCTTCTCACCGGATTCGAACGTTGGGTCCTTTCTCCCACACGATTCCATGGGCC
CCCCAGGGTCTTCCAACTTCCAGCGACCACGCAGTCAGACGCTGCCGGCTCTCAACTTGGACTACTTGAATCAGCCGCAG
AACGATACTCACTCTCAGAACATCCACGACGCATCGGCGGTCTCGATGCCGGAATCCATGACGCCCAAATACCACCTTCA
CCACGTGCCATCATCTGCACCATCGTCGGCGGTGGAATCGCCAATGACCGAAATGTCAGCAACCTCTTACGGCATCGAAA
GCAACGTTGTATCGCCACAGCTGCGACGAAGCAGCAGCAGCAACAGCCTGATGATGGCTATACCGCGCTCGGCGGGTGGT
ATTGGCGGCTCAACCATGGGGTCTCACATGTCGGGTGGCTCGTCGCCAAGTTCGCCTACCCAAGAGGACGCCCAGAGAGC
GGCAGAAACGCTCCTGTCGTTTATCCAGAGTGTTCCCAGCAACTTCGACAACAATGATTACATGGCGCTCCTGCGTCTGT
CTGAGAAGCTACGCTCCCATCATCATCAGCAGCATATAGCGAAGGCTACTGCTGCAGCCCAAGGCATGGGCGGCCTTACG
CGGATTCCCGAAGGAGACGTGGAGATGGCCAGCGATTTGAGCCATTCAAAGCTGGGAACTACCATGACTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62