GenePrediction:GLEAN_1153 Details

Name: GLEAN_1153
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:918878..920609 (+ strand)
Length: 1732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:918878..919170 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_173:919233..919308 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_173:919383..920609 (+ strand)
Length: 1227
>GLEAN_1153 class=GenePrediction position=GCSC_173:918878..920609 (+ strand)
ATGGCGTCCTCCTACCCGCCAGCGATTGCCAAGCCAGAGCGCCAGCGATTGGTCGAGGTGATCAAGGACTGGAGCATAGC
CAATGGGCTTACGGTCCGGCCGATGCCCACGGCCGTGACGGCCAGCGACAGCGATCTTGCGAGCTCGCTGGCCATGCCGG
TGCCGGTGACACTCTTCCCCAGTCCGTTTCCGCGGGCGGCTTTCCACGAAGCCCAGGCGGTGCAGACGGCCTACAACGAG
CTGTATGCGGGCATCAGCCAGGACGAGGAGTTCCTTAGCCGCATTATCGCTCAGTACGTCCGACGCTGTGCCTTGTGTTT
TTTGTCGTACAGGTCCCGTGTCTAACTGCTGCCAGGGTGATCGATGGCGATGACTTCACTGCCAGCCTGTGGAATGTGCA
TCTGCGCGTGAAGAAGGAGGGCTACACACACGTGCGTTTTATTTTCTTTTCCGCCTTGTTCTGCCTGGTGTTTCTGTGTC
GGTCCACTGACAAAGCTGCTTGCAGAAACACTCGCTGGGCATCTTCCGGTCGGACTATCTGGTGCACCAGGAAGCAGGCG
ATGGTGACAGCACACAGCTGCCGATCAAGCAGGTCGAGTTCAACACCATTGCAGCGTCTTTTGGCGGGCTGTCGGTGCAA
GCGGCCAAGCTGCACCGGTTCCTCGCCGAGACCGAGTACGGCTACCTGCAGGCCGAGCCGACCGGCCCCTCGCGATACGA
CTTGCCGGCCAGCACGAGCAGCCAGGACATTGCAGCCGGATTGCGTGCTGCATTTGACGTGTACGACCGCTCGGAGCCGG
CGACGCTGGGCCTGAAGCGCTGCGTGCTCTTCCTTGTGCAGGACGGCGAGCGCAACGTGTTTGACCAGCGGCACATTGAG
TACCACACCAGCGCGGGCGGGCGGGTGCCGGTATTTCGGGTGCCATTCAGCGCCGTGCTGCAAAGCACACGCGTGGCCGA
CACGCCACGGCGCCAGCTGTTGTTCCCGCTACCGACAGACCGGTCGCGCGTGTTCGAGGTGGCCGTCGTGTATCTGCGCG
CCGGCTACGGACCATCCGACTACCCGGATGCGGCCGCCTGGGAGGGCCGCTACCACATTGAGCGGACGGCCGCGATCAAG
TGCCCGACGGTGCTGACGCAGGCAGCCGGCACCAAGAAAGTGCAACAGGTGCTGGCCACGCCGGTGAACGAATCCGAATC
TGGGTCCGAGTCCGGGTCCGGGTCCGGGTCCTCGGAGCTCGGCCGCTTCGTCGCCGAGGACAGCGACAAGGCCCGCCAGA
TCCGCCGCACGTTCACCAACATTTACCCGTTGGACACGACGTCTGCGGCTGGCCGACAGGCCCGCATTTGGGCCCAGGAT
GTCGAGGCGTGCCGGCGATTTGTGCTCAAGCCACAGCGCGAAGGCGGCGGGAACAACTACTACAAGGACAAGATCCCGGC
CCAGCTCAAGGCGGTGCCCGAGGAACACTGGCCGTCGTATATCCTGATGGAGCTCATCACGCCGCCGCCCGTGGCCAACG
TGATCCTGCGCAACGGCCAGACCGAACAGGGCGGCGTCATCTGCGAGCTGGGCGTCTATGGCACCTGCATCTGGGCGGCG
GGCGGCCGCGGCAGCGACACCATCGTCCGCAACGAGACGGCCGGTTATCTGCTGCGCACCAAGGGTGACCAGAGCGAGGA
GGGTGGCGTGGCTGCCGGATTCGGATGCATGGACTCGGTCAACCTAGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62