GenePrediction:GLEAN_1154 Details

Name: GLEAN_1154
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:922398..924402 (+ strand)
Length: 2005
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:922398..923004 (+ strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_173:923055..923574 (+ strand)
Length: 520
Type: CDS
Source: GLEAN
Position: GCSC_173:923636..924176 (+ strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_173:924262..924402 (+ strand)
Length: 141
>GLEAN_1154 class=GenePrediction position=GCSC_173:922398..924402 (+ strand)
ATGGTTTACTACTCTAGCACCGGCGTGCTCATCATGGGCGAGTCGGGTCATTTGCCCATCACCAGCTCGCTCCTGGCCAA
CCTTGTCCTGCGTCTCATTCTCGGGCCGCTCGCCTTGTTGGCATCCTGTGTGCCTCTGCGGCTATTGTGGAAGAACGGCG
AGTTTCCGGCCTGCGTCTTCGTCGCCAGTAACTGGCTGACCGTCCTGCTCGTCTTTATCAACGCCGCCATCTGGCACGAC
CAGGACTTTGACCACTGGTGGCTCGGCTACGGCTGGTGCGACTTCCAGATCTACATCCAGTTTGCCCTCTCGACCGTCTA
CAGCGCCAGCATCTGCGCCATGATGCGACGGCTGTCCATACAGGTCAGCCTGAACCGTGTGGCCGGCCTGTCCGGCGCCG
AGAAGCGCCGCCAGCTGCTGGTGCAGATGCTCATCATCTTTCCCGTCCCGCTGCTGCAGGTCATCTTCACCATCTTTGTC
CAGGGGCAACGCTACATGCTCGCTCCGGTCAACGGCTGCAACAAGGCCTACTACGGGAATGCCATCTACCTCGTCTTCTT
CGTCCTTCCCTCGCCCATCTTCACGGCGGCAGCATGCTATCACACATGTGAGTAATGCGGTTCTTGACAGGGATGGGCCC
TCAGCTGACTGCTTCAGACCAGACGTACAGGAAGTTTCGCCTGGCTGAGGCCAGCACGCGCCTGGCCCATAACGGCAACA
ACAGTGTGGCCTTCTCTCGCAGCCAGCGGGCCCGACGGAAGTTGTATCTGATGGCCCTTAGCATCCTGCTTCCATACGCC
CCCATTGAGGCCATTTTCTGTGCCATCAACATCATGATGGGCTGGCCGTGGAACAGCCCGACGAGCTTCCATTATGTCCA
CTTTGCCGGCATTGTCTCTACGTGGAATTCCATCTACATAATTAGCTACGACCATGTCAGCTTCAGCGAGATGAACCTGA
ACTGGATCCCCATCGTGACTGCATTTGTCATTTTTACCTTTTTCGGAACGTCCAAGGAGGGCATCAACACATACCGCAGA
TGGCTTGTGTTCTTTGGTCTGGGGCGTCTGTTCCCAACACTCAATCTGGAGTACGACCCAGACCGCACCCGTGTCGAGAC
CGGCCGCTTCAGTGAGGGCACGCAGACGCAGTTTTCGACGCTGAATGCATCTGCAAGGTAACGCGACGGGCCTCCTGCCC
GGTGTGCATTGGTAAGAACATCACTGACACACATCTAGTCCATCTCGCAAGGAATCGCTTGTCCCCACATACTGTCGGGT
TTACTCGGCACACGGAAGCAGCCACGGGACAGAGGACCAGGAAGGGGGAGGCGACACGACCGTTGTGCCAGCGCCGTCTT
CGTGGCGATCCGATCTGCGAAGCCGCCTTCAGAAGGCCAGGATGTGGCCCACGCGTACGTCGTCCCCCAATACCGCAGAC
GAGCTCGAGCTGGAACGCAACGCGGCCCCGTTTGCCGCGACATGGCAGCCGGCAGCCTCTGTGATCTTCAGACCTGGGCT
CAACTGGTCTGCGCCACCCAGAGTGCCAGCTCTCGCCATGTCCTCCTTCCGGAAGGCCTCCTCGGCACAGACGACCCCGG
ACACCCGTACAAAACCAAACCCACCGCTACGGCCATGCCAAGCCCATCCGTCACCGCAGTCGGCGGTCCCTGTCATCGAC
GATCCAGACCAGCTGACCGACGAGCTGACCATCGAGCCCCTCCGAGAAAACCGGGCCATACCCAAGCCTTTCGACGGCAC
TGTCATCCAAGGAGCCACTGTGAGCACGCGGGTGTGGGCAGAAGGGGAGCCCATGGAGCCCATGGAGCACATGGATCAAC
AGGGACATACGCTGGAAAATACAGGCGGAGCAGCAGTGCCAGCTTCAACAGTTGGCACAAGTCGGCCAGCTGCTGCATCC
GGGCAGGGGACTGTTCGAGTGGATCGGTGCATCGTCACCGATATGCCCGCTGGAAGATGAAATGACCGTCTGGTCACAGG
TATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62