GenePrediction:GLEAN_1156 Details

Name: GLEAN_1156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:940095..941804 (+ strand)
Length: 1710
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:940095..940385 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_173:940623..941804 (+ strand)
Length: 1182
>GLEAN_1156 class=GenePrediction position=GCSC_173:940095..941804 (+ strand)
ATGGATACTTGTGCAGGCCAACCGCAAGCCGTTAAGACCGATTGGGTGAATGCGCAAGCAAGTGGCGACTATTTTACTGT
CCGCCAAGTCGACCAGTGGTACATAACACCAGCGCGAGAAGCTCATGTCCAAGAGCTTGTCGAAAGCTTCCCTCGTGCCC
AGGCTGTTCAGAACGGCCGTGCCGCCAGTACAACAGCTCCTGTCTCACGCTGTTCAGCAGTCAATGCCATGGATTATCAA
GAAAACCATTTGCCAGCACACTATCATGGGAGTGCTGATGATATTTCCGAGGTGCGTTTCAAGTCTTGAACCTGGTATGA
GTTTCAGTAACCACTTCGTCGGTTCTCTCGCCATGTTGAAGAGATCCTATATTGCAGACGTTGGCCTACATACTGGCCGT
CTCTTTCTTGAAGACGCAGCCACGCCCATGGGCCATTTCCCTCCCCCCAAGTTGAATGCAAAGCAAAAGAACAACCATGC
TGCAAGACGTATAGTTCGTTTCTGGAATCTCACTAACATGTGGCGCAGGTCCTGGGGACACATGGCACAACAGCGGGCAC
CGGTGCCATCAACGATACCGACAATGACATGTCCGTCTTTCCCTATCCATCTTCGACAGCTCCCACACACATGACATCGC
AGGCCACGACATTCGGCATTAGTTCAACGGGCAATCTTGACCCAGTAACTCTCCACGCTGGCCCTGGCTGGCATTCTTCT
GATCAGAGTCCCATTTATAGCGGCGACGAGGCTGGTTCAATGGCTGCCCACTCGTCCCTGAACCCCTTCAATTTCCAACA
AGAGTACAGCGATGATACCGATCAAATTCAACACCAGGAGCAGGCTGTGATGTTCAGTAACGGCTATGTCGCGTCGCCAA
TAGCCACCTCACACTTAGCGATCCCATACGCATGGGACATAGTGAACCCAGCAAACTTGCAGCCCGAGATCGGTGGATTT
CATCAATCCTCGCCAGCTGGCAGAGCAGCTCTGGGGCTTTTCGGCACAGACCAAAGTGCCGAATCGTATCCGGACCAACA
CAGCGGACAGACGCTCGAATACTCCGAGTCGGGTATTGGACGAAATGGAACCAGTTCACTGCCTGGCGATGCAGCCGAGA
CAACAAAGGGCAGACCACATATCAAAAGAGCAAAGACCACATCACGTCAGACCTCGTCTATGTCTGCCAACAGCTCTGCA
AATGCCAAGGGGATAGCATTGGCACCCATTATGCCTGCATCGGTCGTTGGGAGCTCCAGAGGTAGCACTCGTTCCAGTAC
AGGAAGCAAGATGCGTTTTGCAACGCGCGCATCCAACAACTTGGCGAACACGGCGGCCATGACGAATATAGCAAGCCGGG
TATCAGAAATACCAGAGGATGGCAAAACAAAGGGCTCCCATAACCTGGTTGAAAAACAGTATCGAAACCGATTAAACGCT
CAATTTGAGGGACTGATGAGTGCGCTCCCTGAGACTCTGAAGTCGCAAGGAGGAAGCGCAGAGTTCGGCGAGGCGAACAA
TCCCGACGCCGCGGACAGACGGATCAGCAAAGCCGAAGTCCTGGATATGGCCCGAATGCACATTCAGAACCTGGAACAGG
AGAGGGATTTGCTCGCTCGTGAACGAGATGGGCTGCGAGAGACCGTGGAAAAATTGAAGAACGACCTTATCGAAGAATCC
GGATCCGCTCAAGGTGTTATGGATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62