GenePrediction:GLEAN_1157 Details

Name: GLEAN_1157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:944938..945756 (+ strand)
Length: 819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:944938..945114 (+ strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_173:945175..945756 (+ strand)
Length: 582
>GLEAN_1157 class=GenePrediction position=GCSC_173:944938..945756 (+ strand)
ATGGACCAAGTGATGGACGGCGGGAGATTCCCGCTCGAACAATGGTTCTGGGAAATGCCTTTCTGCACACGATGGTGGAC
CACGACAACATTTGCCATTAGTGTTTTAGTGCAGTGCCAAATTGTCACGCCATGGCAGCTGTTCTATAGCTATTCTTCTG
TGTTTGCCAAGGGCCAGGTAGGTTTTGTCGTCATGTCGTTTTTTTTTCTGACAGCATGGAGTCTAATACCTATATAGTAC
TGGCGGCTACTTTCGACGTTCCTTTACTTTGGCCCCATATCTATGGACCTTGTCTTCCACATATACTTCCTTCAGCGATA
CTCGCGTCTACTCGAGGAATCAGCCGGTCGTTCCCCCGCCGTCTTCTCCTGGCTACTCGTCTATGCTATGGCCTTCCTGC
TCGTCATATCATCTTTCATACATATGCCCTTCCTAGGCCAGCCGCTGTCATCGACACTCGTCTATATCTGGTCTCGACGG
AATCATAACACACGTCTGAGCTTTCTTGGTCTGATGACGTTCAGCGCACCCTACTTGCCGTGGGTGCTAATGTGCTTCAG
CCTGGTTCTCCACGGAAGCATTCCCCGAGACGAGATTATGGGTGTCGTCATTGGCCATGTTTACTGGTTTTTCACAGACG
TGTACCCGCCACTGCACAACGGGGTGCAGCCGTTGGCACCACCAAGCTGGTGGCGGTGGATTTTTGAGGGCCAGCGGCCA
CAAGCCAACAACGACATGCAAGCTGTTGATGAGACTGCTGGAGCCGTCGACCAAGACTTTGCTGCTGCGCGCGCTGAGCG
TATTCCAGAACTGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62