GenePrediction:GLEAN_1158 Details

Name: GLEAN_1158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:948597..950649 (+ strand)
Length: 2053
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:948597..949359 (+ strand)
Length: 763
Type: CDS
Source: GLEAN
Position: GCSC_173:949423..949494 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:949557..950011 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_173:950086..950649 (+ strand)
Length: 564
>GLEAN_1158 class=GenePrediction position=GCSC_173:948597..950649 (+ strand)
ATGCTTGTGGAGGAGCGAAGATTGGCGCCTCAATTATCACAGCCCGAGTCTTTCAGCCTCGTTGAAACATTTGGTCCAAA
CTCTACGGAGCTCTCAACCGTCCGAGCACCCGACTCGCAGATGGAGGATCTTTCCTTTTTCTGCGATGGCGGAGACTGCG
ACTCGCTCTTGCAAGGCGAGGACCAGGACATGGAAAGCCTTTTTGGGGGCGATGATGAGTGTTCGACACCTTTGTCGACA
TTGAGCCCATATCCACAGACGAGTGTGCTTGCGCTTCCAGACACTCAGCTGGCGGTGCCTGCCGAGCCGGCAGCGGCTTG
CACCCAGCAAAGAGACAGTGACGTTAGTACTCTCCCAGAGCCTCAGCAGTGCAGAGAATTATGGGGTTTCCCGCTCCCAG
ACCCAGCATCAGCCGCAAATCTTGATCTTGATCAAATAGAAGACGAGATGCGCGAGTTGGAGCAGATGCTGGCTGCTGAT
CAGGAGCGGGAGCGGGAGCTCCACGAGGAAGAGGATGGAGAGCATCAGAGCGGCCAGGAGGGCCCACCGCAACAACCCAT
TGACACTCCGCATAGTGAAGCAAGTCTATCGTCGGAGCCGGCCTCTTGGCCCGATCAAACCGGCCAAGGCGGCGAGAACC
ACGTGACTGTCTACGATGTCGACGCCGACGGAGTCGATGAAGACGACGACGTTATCTTCATGGGCCAGACAAAGGCAAAT
ACACAGACCCAGGCTTTGCATCCAGGGATGGCCGCAGGATGTGGTGCGGCTCCAGAATTTGTGATGCCAGCTTTGCACTA
CCTTGAACTGCGACCTCGCTGCCCAGATGGTCCTCCACCGGAGAGCATTCACCTACGTGAGCGAAGCATCGAAGAGCTTT
TGCCATATGTGCAGCTCGGTGAGTACTGCTTTCTCTCCCATTCGCGAGGTTCGATCCTTACTAATTTTCCTTTATTGCAG
ACGCAAAGATCTCTCTCCAGGCCATCTACGTTATGCTTGACATCAGCATTTCTGCGGGTAGGCTGATAAAACATGAGTGT
CGCCAGTATCTGACCAAACCGGAACATGCAATCCATTCAAGCGGCAGTAAGGATCCCGTGGCTCTGCGCACACGCAAGGT
GACCATTCTCTTGAGCTCGCTCGCTTTTCTGTCCGAGTTGGGCATGGGTGAGCGATGGTTCGGGCAGGCGTTATTGATGA
ACCCCAGAAGCAAGTACGTCTGGCCAGCGGACTCGACCAGGTTGACTCTGCTCTTCGTCAAGCTACTGTACAAGCTTCAA
CGCAACAAGGAAATCAAAGATAGACGGAAGCCCAGTCAGGTCTATCGTCCCAAGCACGGACCTACCGCGAACACGCCTTC
TGGTTTGTCGTCCACAGCCCTCTCCATGACGGGATTTGCGCATGATTCTCCATCGGTGAGTTTACGGGTTCCCTTTTCCC
GCTCTTTTCTCTCCTGCTGTTATCAAATTGCTAATCAGACGTGTCATAGTGTCTTCGAGAGCGGCTCGCGACAGCCCAAA
AGCGTGGTTTTAGCGAACTGGACGAGCCGGTATCGACAGAGTCTTCGATTTCCAGATCATCCTCTGTAGTATCGGCTGTC
ATGTCTGCACAATCCCCAGCATCCTCTGTGACATGTACAACGCCACCATTACACCTTAGCGACTCGGACGGCCTGGTCTG
CGATAGTGAGGCGACATCTCAGCATCGGCTTGCTAAGAAGAGGCACCAAGCCAACGCAACAGGCGTGTGCTATATTGCGA
AGGCGCCCGACGATGCAACGATTCGGTACTTCATCAACATCACGCGAGGGTGCGAGAGGGTACTTCCTCGGTTGGTGCTC
GGCCACACCGACTGGATGCGCACGGCTGGGTACTCTTTTCTGACGAGTCGATGCACAGCGATGGGCTACGAGGTGGCATC
GGTGGCTGTCTGCACTCTTCTTGGACTGGAAGAAGTTGGGAACGACCGGGAGTGGGACCGGGCAGTGTGTCGCGTGCACG
AAGCGATGCTGATGGATGATGAAGTTCGGGTTCTGGTGAATCTGCAAGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62