GenePrediction:GLEAN_1159 Details

Name: GLEAN_1159
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:951600..954071 (+ strand)
Length: 2472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:951600..951794 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_173:951853..951898 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_173:951959..952051 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:952132..952236 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_173:952296..952556 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_173:952615..953458 (+ strand)
Length: 844
Type: CDS
Source: GLEAN
Position: GCSC_173:953528..953866 (+ strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_173:953921..954071 (+ strand)
Length: 151
>GLEAN_1159 class=GenePrediction position=GCSC_173:951600..954071 (+ strand)
ATGAGACTATCTGCCTCCTCCGCGGTTGCGGCAGCACTCCTACCGGCAGCGGTTGTCGCCTGCGACAGCTGCTATGGTCC
CACGAACACGGTCGAGCATGTCCGGCACGTCAAGCGCATCCAGCCAGGAGCTCAGGAGGCCACGTACGGTCCGACACGGC
CGCTCGAATGGGGTCAGCTGAACGTGATGCACACGGTGAGTCTTGTCTTTGTCGCATCAACCGCGCCCTCTTCTCCTGGC
TGACATCTGGCAGACGGACACGCACGGCTGGCTCGAGGGCCACATCAAGGAGCAAAACTGTGGGTGTAGACGGAGCTGGC
GGAGAGACGATGTGTGGCAGGCAGGCTGACCAGAGACAGATGGCGCCGACTTTGGCGACTTTGTGTCCTTTGCCACGCAC
CTGAAGCACAAGGCTGGCAACATGGGTGTCGACCTGTTGCTGGTCGACACGGGTGGGTTCTCCTTTGTTTCTTCCTTGTT
TCTTTCTGTCTTTTTTTTCTTTTTCTTCAGTCCTTGTCTGACAGCCTTTCAGGCGATCTCCACGACGGCACCGGGCTCAG
CGACACCACGACGCCCGATGGCAAGCTTACCAACAAGATCTTCGAAGAGCTCAGCGCGTATGATATTCTGACGATCGGTC
AGCTCTAACCCGACCTTGTGCTGTTGTTTTTCTTTTCCATGGCTAATACATGACAGGCAATCACGAGCTATACTTGGCTG
AAGTGGCGTACCAGACGTTCAGCGAGCTCAGCAAGTTCTGGGGCGAGAAGTATCTCACATCCAACGTGCAGATCCTCAAC
CAGACGACGAACGAGTGGCAGTACATTGGCCAGAAGTACCGCTACTTCACAACACCCAAGGGTAAGGGCGACCGCTTGAC
AGGCGAAACGACACGCTTGCTGATGAGATATGCAGGCCTCCGGATCATGGCTTTCGGGGTTCTCTTTGACTTTAAGGGTG
AGTGTCCGGACTCTGCACGAGTTCTGTCCAGCATACTCACAGTACATGGCACTAGGCAACACCAATGTGTCCAAGGTGAT
CCCGGCGGCGACGATGGTGAAGCAGGACTGGTTTGTCGAGGCAGTCAATGCGCCGGAGCCGGTAGACCTCTTCCTCGTGA
TCGGGCACAACATTGCGCGGCCGACGACCAGCGGCAGCACATTCCAGACGGTGTACGAGGCGATCCGGACGGTGCATGCG
GATAAGCCGGTGCAGATCTTTGGAGGCCACAGCCACATCCGCGACTTTGCGGTGCTGGATGAGTCCAGCACGGCCTTGGA
ATCGGGGCGGTACTGCGAGACGGTGGGCTGGCTGGCGATGAGCGGCTTTGACACCGACAACAGCGGCTACCACGGCGTGC
ATGAGGCCCATGGTGTGCCTAACCCGACGCGCAAGGCGACGGCCAACGCGACGGGCCCGTGGATATATGCGAGGCGCTAC
CTGGACTGGAACCGCTACACGTTTTCCTTCCACGCTGTCGGCACGGGTTCGAGCAATGCCACCGGCTTCGACTACCACAG
TGGCCTAGCGGTGACGGACGACATCAGGCGCGACCGGTCGTCGCAGCGGCTCGGCGAGTTGTACGGCTGCGTGCCCGACT
TCTACTGCCAGACGTGCGTTCCATTTGGCAACGAGACCAACATCTTCACGCCGCTGAGCGACGCCCTGGGCACCAGCGTT
GTCAACACGGACCGCGCCGACCGTGCCCGCATGGTGTACAGCAACACAGGCGGCATCCGGTTCGATATGTACAAGGGCCC
ATTTACGTACGACGACAACTTTATAGTATCGCCCTTTCGTGACGCCTTTTTGTATATCCCGGACGTGCCGTACAGCCTGG
CAGAGGGGCTGCTGAACGGGTGAGTGGTCGTTGTAAGAGTGAAAGAGGCAAACAGACCAGGAGGCGACTGACCACCGACT
CCCTGCAGACTCAACAATGGCGGCGTGGACAAGCGTGATGGCCCCCTGGCCCTGGCGGACACGGCAGCCCTGCTCGGCCG
CGACTCGTGTGTCGACCCGATTGCAGGCGTGACCAGACGTGACGATATCAGCGGTAGCAGCAGCCACGATCACGGCCACG
GCATTGTGCGGCGCCAGGTGACCACAGAGACGGCCGGCTACACAACGACAGACGACTTTGGCAGCGATGGTGACGACACG
GCGCATCAGAAGATCCCATACTATAGCATTCCCAATTACTTTATGGGCACGGGCGGCTTCCCAGAGTCAGGTGACCCGGA
GAAGGTGGACGTTATATTTGTGGACTTGTAAGTGAACGACAGACCAAAAGGAGAGGGCGAAAGGGCACTGACCAGTGGCA
GCATCGAGTCCTTTGTGCTGGATTACCTCGGATCGGCCTACAACAGCAGCATGGTGACGTACTACATCTCGGAGAATTTC
ACGTCGCAAGACTACCTCTTGCCGTACGTGAAGTCAAACTGGCAGACGGGTCTGCCGGACTGCCCGATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62