GenePrediction:GLEAN_115 Details

Name: GLEAN_115
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:797633..798832 (+ strand)
Length: 1200
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:797633..798628 (+ strand)
Length: 996
Type: CDS
Source: GLEAN
Position: GCSC_179:798686..798832 (+ strand)
Length: 147
>GLEAN_115 class=GenePrediction position=GCSC_179:797633..798832 (+ strand)
ATGGCAAATTGCCCCATTCGGATCCTCGATGGCGGTCTCGGCACCTCGCTCCAGGACCGCTATGGCGTCGAATTCTCCTC
CGCCGCCACGCCGCTCTGGTCCTCCCACCTTCTCGCCACTGGACCTCAGAGCGAGCCCGAGACCCTGCTGCAGCGCTGCC
AGGCCGACTTCTGCCGCGCTGGCGCTGACGTCCTCGAGACCGCCACGTACCAGATCTCGACAGCCGGCTTGGCGCGCACA
CGCGTGCTGCCCGATCATCCCGATGGCATCGTCGAGCCTGCAGATGTCTACCAGTTTCTCGAGCGGGCCGTCGCCGTGGC
CGAAGCTGCTGGCAATGTCGAGACAGAAGCAAAAACAACGAAACATGAGACAGCACCCTCCATCGCCCTCTCCCTCGGCC
CCTACGGCGCCTGCATGATCCCCAGCACCGAGTACTCGGGCGCCTACGACTTTGACGGCCGCAACACCACCGCCCTCCGT
CGCTGGCACGCCGACCGTCTGCGGCTCTTCGACGTCGGCGTCAACCGTCTGGCCGACCGCGTTCGCTACCTCGCCTTCGA
GACGGTGCCGCGGCTGGACGAGATCGTCGCCGTGCGGCAGCTCTACAACGTCAGCGGCAACCACGGCGACACTGATACGA
TCCCCTCTCGACTGGCCGCCCTGCCCTACTGGATCTCCTGCGTCTTCCCCGGCGACTCCGCCCACGAGCCCCCGGCCACC
CTCCCGGATGGCTCCACCGTCGAGCAGGCCGTCGAGGCTATGCTCACGTCCTCCTCTTCGACACATCTTCCCTGGGGCAT
CGGCATCAACTGTACCAAGATAGGCCGTCTGCCCCAGTTGATCGAGCGGTATGAGGCTGCCGTGGAGAGCCTCGTGGCCA
CCGGCCGTCTGTCGGACTGGCCTGCCCTCGTGCTCTACCCCGACGGCACCAACGGCGAGGTCTACAACACCACGACGCAG
CGGTGGGAGATGCCTGCGGGCGTGTCTGCGCCAAAGGTACGTTGAGTCTGCATTCCCATTGACTCATAGCATCCTGACAT
CTTCTCCGTCCAGGACCCCTGGGAGGCACAACTCAGCCAGATGGTGCTGGATGCTGCAAGCCGAGGAAAATGGCGCGAGA
TCCTCGTCGGAGGCTGCTGCAAAGCCACAGACCGCGACATCAAAGCCCTCAAAGCGTCCCTGCGAGAACCGCGTCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62