GenePrediction:GLEAN_1160 Details

Name: GLEAN_1160
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:964243..969144 (+ strand)
Length: 4902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:964243..964336 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_173:964401..964663 (+ strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_173:964714..964980 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_173:965046..966158 (+ strand)
Length: 1113
Type: CDS
Source: GLEAN
Position: GCSC_173:966233..966324 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_173:966673..967538 (+ strand)
Length: 866
Type: CDS
Source: GLEAN
Position: GCSC_173:967652..967705 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_173:967775..969144 (+ strand)
Length: 1370
>GLEAN_1160 class=GenePrediction position=GCSC_173:964243..969144 (+ strand)
ATGTGGAACGACGAGGATAACAATCCCTACGGGAGCAGCTTTGATCGGAGGGACTCGTTTGAGTCGTCCGTAGCTCCATC
GTCTCCGGATAGCCGTGAGTGTTTCTGCCTCTTATCCGTACTTGTGCTGCAGATGAGTTCTGACAATACCTGTTTTAGAT
GCCCGATACAGTGCGCCTTCCACCGACGATGAGCCGGATATCATTCCGAGCTATGGCAAGTCCTCGAGCGACGACGATAG
TGATGAGGAAGTGGCGGCAGAAGCCCCCAGTGGACTGCAGCCCAGGCGGAAGCCTGGCGGTTATGACAGCCGCGTCGAAC
AGATTCTCTACGAAAACCCCGAAACCCCCATTTTGATTGTAGATGCTGGAAAGAGCCCGGAAAACAACGGACGCTTTATT
GTGTATACGATCCGGACAGGGGTGAGTAATTGACGGCATGACGAAGCGAAGATGAGGCTAAACGTCAATAGGATCTCGAA
GTTCGAAGGCGATACTCGGAGTTTGCCTCTCTGCGCGAGGCTTTGACGCGACTGCACCCGACCCTCATCATTCCCCCAAT
ACCTGAAAAGCACACTATGGCCGACTACGCGGCAAATCCGACGAATGCGAAACAGGATCAGCAGATCATCGATCTACGGA
AGCGCATGCTTGCAGTCTTTCTCAACCGCTGTCGGCGGATGGAACAGATTCGCATGGACGGCGTCTGGTGGCGCTTCCTC
GACCCCAACGCCAGCTGGGTACGTTCGCCAGGGTGTATTGTGCGCAGTATTTGGGGCGGGTACTAATTTTGGCATGCATG
TAGAACGAGGTACTGCACTCACATCCCATTGCATCGATTCCCAAGTCGATTTTGAAAGCACCACCGTTAGATCCGGCAAA
CCCAACGCCAGCACATGCCTACCTACCGATACCAGCCAACTCGGCCAGGCTCAGGGTCCCGGCAGGGATCAGTGTACCTT
CTAGCGACGATGCCGTCTCACGGTTTCCTCCAGAGTCGGCGCAACTCAGCGAACAGGAGCTTGACCCTTACTTTACGTCC
TACGAGGCCTCGAGCAAAGAGCTCGAGCAGCTGCTGACAGGACCGATGGAGAAGGTAAACCGGCGCACGCTCAGCCACCT
GTCAACTCTTGCCTCGGACCTGGCCGAGCTCGGCGCTCGGTACAATGCGTTTGCACTCTCGGAACAAGCACCAACGCTAG
GACCGGCTATCGAGCGAGTGGGACAGGCAGTGGACTCGTCATACATTGCGACCGAAGAGCTCGCAACGTCTCTCGGAGCC
AGCTTTGCAGAGCCAATGCGTGAGCATGCTCAGTTTGCGGGAGTTGTGCGCACGGTGCTTCGGTACAGGATTCTGAAGCG
GGTGCAGCAAGAGATGACCGACGAGGATCTCATGAAAAAGCGGGCGCTGTTGGAGCAGCTGGAGCGGAGCGAGGCAGAGG
CGCGGCGCATCGACCAATACCTCAGCAACAGCCAGCAGATCCAGCCACCACGGCGGTCAAACAGTGCACGGGATCCTTCG
AGCGGGGGGCGGCACCATAGGGATGGCAGCCAGGAGGATACGGCATCGATCGACTCTGACTTCCCGCCGACACATGGCGA
CTATTCATCTGTACCGTCGGCTAAGAACGGACCGCCAGAGCGCAGTGTGCCGACGCAAGGCCACAGGAAGATGCCAAGCA
GCAGCTCAATCACCAACAAGATATTCGGGCCGCTGCGACATGCTGTGCAAGGCGTTGTGGACGTGGACCCGGAGAGAACG
CGGCGGGACACGATCACGAAAACGCGGGAGTCGATTGCGCATTTGGAGCAGGCACAAGTAGCGTCTGCTCAAGACGTCAA
GGATGCCAGCACGAGCGTGTTGCACGACCTGAAGCGGTTCCAGCTCGAGAAGGAGGACGATCTGAAGCGGTACATGGTAA
GGCTTTCCGTTGATGTGGTGCATAGATGCAGATGCAGATGCATATGCAATGCTAACGGGACACCTCTCAGATTGCCTACG
CGAAAAGCCAGATTGAGTGGGCGAAAGAGAACAAGGAGACATGGGAAGAGGCACGGGCAGAAATCAACAAGATCGATGAG
TCGTAGTTTTTTTTGGCTTGGTGTTTGTTTTCTGCATGCGATAACTCTGTAGTATCTTAGTCGTGTCATTTGACGGGCCA
TGCATGGGCCTAATACCCGCGACAGAGGCGCCGGTGAAATGGAATAGAGAATAATCCCTGCTGGTTGTTGGTAGCGCTAC
GTAATCGCCGTCATTCGCCTAGCCTTTAGCCCTACCAGCTACGGAAGAGCTGTTGTGGAGCAGCCGGATCCGCTACAGTT
AGTGTCTGGAGCTGTCTCCTCCTCTCATCGTATGGTTAGATCACCTGCTATCACTTGGCACGGGACAACAAGTAACAACG
CAGCATTTGTGCCCGACATTGCCTTTCAAGCTCTACTTTGGCGTTCTTCTTCCTCACCGAAGCGGTGATACAATCCGGTG
TCAACGATAGAAAGAAGCACTACCTAATTTTCAACCCATCGACGGATTCCGGGAACTCCTCGTGTCTCTACGACAAAGCT
GCCCCCTTTGGGTCCTCTGACCAAGCGAACGTCTCTCCCTCCGGTCCTATGCCGGCTCTGGGGGCGATCTCGACAGCGGC
CGACAGCGGCGAGCCTGAGCGGCCGACGCTGCCGGGCGTAGATACGTCCCATGGTGGCAACGACCAGGACGACGACCGCG
ATGGTGGCGAGCACTCGCCGCTGCTGTCTGCCGAGCCGTCGGCCGACGTGGACGCGAGCCGGGTGTCCGAGGCGACGGGC
GGTCTGCGGCACCACCACCACTTCGGTCACGGGTCGTCGGCCGACGAGGCTGCTGCTGACGAGGACGAAGCCCAGCGACA
GCGAACGCGGTCGGTCTGGTACCTGATGCTGCTGACGCTCAGCATCGGCGGGCTGCAGATTGCCTGGTCGGTCGAGCTGT
CGAACGGATCGCCCTTTTTGCTCTCGCTCGGCCTGAGCAAGTCGCTCATGGCACTCGTCTGGATCGCTGGCCCGCTGACC
GGCACGCTCGTGCAGCCGTATGTCGGCATGCTCAGCGACAGCTGTCGCGTTCCGTGGGGCAAGCGGAAGCCGTTCATGCT
GGGCGGCGCGGCTGCTACGATCGTGTCGCTCATGTGCCTCGCCTGGACGCGCGAGGTCGTCGCCGGCACGCTGCACGGCG
TCTTCGGCGCTGATCCCACGTCGGGTGGCGTCCGCACGGCCATCATCATCGTCGCCGTCTTCTGGGTCTACGTGCTCGAC
TTTGCCATCAACACGGGTACGTTGGACAGCTGGGTCGCTCCTGCCCTGTTTCTCTTTTCTCTCGCCTCCCCCTTTTTCTT
GGTCATTTTCTCTCGCTTTCATCCTCATTCCAAAAACTGACAACAACAGTCCAAGCAGCCATCCGGGCCTTCATCGTCGA
CTGTGCTCCAGCCCATCAGCAAGGTGTGTTTTGTTGAGCATCTCATCCCCACCACAGCAGTCACACTAATTTCGGCTCTC
TCCCAAAAACAGAGGCTGCCAACGCTATGGCCAGCCGCATGACTGGACTCGGGAACATCATCGGCTATGTGGCAGGCTAT
GCAAACCTACCCACGTTCCTCTGGTGGCTCGGTGACACGCAGTTCAAAGACCTATGTGCCATTGCCAGCGTTGCACTCGG
CTCAACCATCCTCATCAGCTGTCTTCTCATCCACGAGCGGGACCCTCGTCTCGACGGTCCGCCATCTGCCTCAGCCAGCC
ACCGACATGGAGTCGTTTCATTCTTCAAGCAGATATTTGTCTCCATCCGCCGCCTGCCGCCCCAGATCAAGCGGGTCTGC
ACCGTGCAGTTCTGCGCCTGGGTCGGCTTCTTTCCCATGCTCTTTTATACGTCCTCATACATTGGCGAGATCTACGTCGA
GCCCTTCTTGCAGGATAATCCTCATATGACACCCGAACAATTGGATCGGCTCTACGAAGAGGCCACCCGCGTCGGCACAT
TTGCGCTGCTTGTGTATTCCATCACGAGCTTGTGCACAAACGTGTTTCTTCCCTTTTTTATCGCGCCAACATACGACACC
CGTCCTGTCGTCGGAGATCAGCAGCGACAACTGGCGGCTCTGGTTTCCGATGCAAGCATCTTCTCTACCCCGAAGTCGTG
GCTCGACTACCTTGTCATCCCGGGCTTGACTCTGCGCCGCGCCTGGATGCTGTCGCTTCTCCTCTTCTCTGGGAGCATGT
CCTGCACCGTGCTGGTGCATAGCGTGGCGGCGGCTACTGCGCTCATCGGCCTCGTCGGCATCACTTGGGCCTTGACGCTG
TGGGCGCCTTGGGCTATTATCAGTGCAGAGATCAGCCGCCGGGATGTGCGGATGCGGGCACAGAAGCAGCAGAAGCAGCA
GCAGACGCTGGCAGAACATGCAAACGGAGACGACTTCGTTGGCAATGGACCCAGTGACGAGGAAAGCGGCAACGAGGAGG
AGGAGGTTGACCAGGCTGGTGTCATCCTCGGCATTCACAACATGGCCATCGCAGCGCCGCAGATGATCGCCACCGTGGGA
TCCAGCATCATCTTCAAGTTCCTGCAAAAGCCGCGTGGCACGCCCGGCGATCACAGCATCGCCGTGGTTATGGCGCTGGG
CGGAATCACTGTGCTCGTAGCGGCCTTTTTCGTTCACCGCATCGAGGACGAGCCCACAGACCTGCTGTCTGGACAGGCGG
CGTACAGCAACCTGCCCGTTGATGACGGCGAGGACGAATATCTGGCACAAGAGGACGCCTCTGACGTGTCGGCGGACAGA
TGTCCTAGTCGACGGCAGAGCAGCGAGCAGTTGACGCGGGAGAGTCAAGACCGAGCAGCGCTGGCACGCGGGTCGAGCTA
CAGCGGGGGTCTAGAATACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62