GenePrediction:GLEAN_1161 Details

Name: GLEAN_1161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:976860..979694 (+ strand)
Length: 2835
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:976860..978676 (+ strand)
Length: 1817
Type: CDS
Source: GLEAN
Position: GCSC_173:978767..979694 (+ strand)
Length: 928
>GLEAN_1161 class=GenePrediction position=GCSC_173:976860..979694 (+ strand)
ATGGATACGGCGGCGCCCTTTGGCGTCTCTGACGAGACCTGCAGCTTGGCCGACTCGGCCTACGAGCTGATCAGCAGCAC
TGACGGTGAGAGTCAGGACGGCAGAGGCACCGACTCCGTTGCCGACTCACTAGACGTATATCCTCGTGCCGATGACGTCC
ACAGCCTCAACGGCAACGATGCCGCATACGATGACGACGACGTGGACGAAGAGAGCGCATCCGAGAACGATGACGCCAAC
CATGAACCAATCTGCACGCCGGCCTCGACGTCTACCCCCAGCAACAGCCGTCTATACCCTGGCAGACATGGCTCAAACGA
AGACGCCGTCAACTGCCGATCCTCTCAGACCGACTCTATTCAATACGCCGAGCACGTCCTCGGTAGCCCTTCGACGCAAT
CTCTATCGAATCTTGAGTATGACAAATCGGGGGATGGCAACGGCCCCACACCTCTCGTGCACTCCATAGAGTTCAGCGAG
TCCGACATTTGTCTCGATAAGGTATCGGTAAAGCACACGATCCGAGATTTTGGTGATGCGGAGTCGGCTGCCATCGCTGG
GGCCTTGAATATGACCGACCCGCCACGGCGTCTGGCCGCTACCATCCGCCAAACCATGTCGCACTATTGCCTGTCGACCC
GTGAGCCCCTAAAGGTTCTGTACGTCGGCAGCGAGGCCGGATACAACGACATCATGTATAAGATCTCGTCCGCTCTGCTG
GCATCCGCCTCGCACAATCGCTCCAGCCCGGGATCTGAGCACCATAGCCCGACCCCTAGCATTTACAACATCATGCCCAT
CTCATCTTTCGGCTCGTCCAAGGTTCCTGAAATTGACGAGATCCAGCTCATGGGAGTCTCTGACTATTACATCAAAGTCG
AGCGTTGTATCGAGGCGGACGAGACGGTTTCTGAAGGTGAAGCCTCTCCCAACGAGATGGTCTATTCGATCAAACTAGAT
AATGAGGAGACCTATGCATCCGTCTTTTCTCCTCACGGCTCTGCGGTGCGTCCTCAGTGGTCGCTGCCCCATGTTGCCGT
TTTCTACGTGTCTGGCAACGACGACGACCGGGCTGAGAAGACGAGAAACGCCGCTTGGGAGTTTATGACCCGGCACGCTG
TTCCATCCATCTTTATCTCGCACGCACAGTCTTTCTCACAACCGACGGGCACCGGCCGCTGGAGAGATTTCGTCGACCAA
GCTGCCGTGCATCTATGCCTAGAGTCACGCGATCCTGAACGTCTCATCATCCCGGAACGCCTACCAATCGACCTGGTGTC
GTTTCTCAACATCGATGCACGCCAGATGAACAGAAATTTGGCCTACCTCACGGGCTTGCACGAACCATCAAAGGCCATGA
CAAACGACTCTGTGGGCAAGCTGCAAAAAGAGGGATATCGCGCTGGTGCAGTCACAGCTGTGCGCTTCCTCTGTAGAGGA
AATTACTTTCGCACGAAGCTATCGCGAACAGTGGATGAAATCAGCGGGCAGCTTGGTGCCGGCCGACTGTTTACGATGGT
TGTTGCGGCCATAGGTGCCTTGATGTGGTTTTACATCCTTCTTTATATTCCTTTCATATCCCCTTCATTCACGGGTCAGC
AATCGGTTGTGGCTGCTACCGTCTCTGCCTCGACGGTGTCTTCTCTGACAGACACAGCAACCAGCTCAGTTCTCAGTACC
TCTTCGGTGGCAACTACATCTACGTCTACGTGCTTTGCTCCCTCTCTGACACCGACTGTCACTATCAGCCTGACGTCCAC
CACGACGGTTAAACTTCAAGTCTCGGAGTCGAGCAGTTCAGCGGTCCAATTTGGAGGGTACCTGACGGACAGAGCCAGCC
GGCAATCCAGTGCATCAAATTCAAACACCGAAATTAAGAGAACGGGCTGCTCAATCCATGTATACAGCAACCATGAGATC
CTTGTCAAGGTGCCTTCTGGCACGAAGACTACATGGCTTGCAAAGGGTGCAATCGACATTGACGTTTGGCGTGGCCAAGA
GCTTCTGAAGTCTAGACTATCGACAACAGACGAAGGAATTATCATCGAAATTAACAAGAAGGACGCGTATGGCGTTATGA
ACGTTTCTATCGTCACGACCCGGAGACCGAAAATCAACGAAACATTCGCTGTTGACTTTGGAAAGCCAACAATGCTACGA
GTGCTAGAAATCGGAGCCAAAACGTGGCTAGACTCGGCACGGACTGCTGCCAATATCTGGCTAGATGCAGCTATGCGAGC
GGAGGGTGCTGTCCATCCGTACATCGACCACGTGGTTGATCTTCTGCCGAACGCAGACGATGTACTTCAGGGCGCAACCA
TGGCAGCAACGTCAATGGCCGACGTGGTGGATTCCATGAAGCATGCAGGCCAAGCAGCTTACGACACGGCCAGCCGCGCT
ACCCAGGACCTAAAGGGACAAATGAGTGCATCTTTGGAGGGCGCCGTCGACAGCGCCAAGAGGGATGCCAGGGCCGTTTT
GGACCGTGGGCTACTGCCGTTGGACCACGCTCGCGGTTCTCTGCAGTTGGCGGTGCTCCGGGCGCAGATTGCGTCGAAGC
TATGGTGGATGCAGGTGAATGGCCAACGGGCTAAGCATGCCGACTATGAGGCAAAGGCGGCGGTATTTCTCCGCGAATCG
GAGAAGGCACTCAAGGCCAATGCGAAGACTGGTGCCCAAAGCGGCACTGGAGACAGGAACAGCCATCAAGGCTGCCAGAT
GGAGAAGTACAGGTGGTGTCACTCGTTTGGCTCTAGGCTATGGAAGAAGACGTCGGCAAGCGAGCCGGGTAGCAGCTGGA
AGTTTCTGAGACGAGGTCGAGAAGTGAGAGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62