GenePrediction:GLEAN_1163 Details

Name: GLEAN_1163
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:999100..1001838 (+ strand)
Length: 2739
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:999100..1001088 (+ strand)
Length: 1989
Type: CDS
Source: GLEAN
Position: GCSC_173:1001197..1001838 (+ strand)
Length: 642
>GLEAN_1163 class=GenePrediction position=GCSC_173:999100..1001838 (+ strand)
ATGTCGGTGTCAGCGCCGCCGCCGCCGGCGTCGTCGACGGGCTCCTCACCACGTGCAGGGCTGTCACGAGATGGCGACAG
TGGTGGAGCTGTTGCAGCTTCTGCTTCTGCTGCTGCTTCTGCTGCTGCTTCCGTCTCTGCAGCTTCTTCCGGCCACGCCT
CACCGGTCTCGCCGGCCACCAAGCCGGCAGTCGGCCGCGACCGCGACACGTTCGACCGGATCCTGGTGGAGCGCTACGTC
ACGCGCGACGGCATCCACTCGGCCGCCCTGCAGGCAGCGCAGGTGCAGATGCAAAAAGACTTTCGCAGCCTGCACATGTT
CGCCGACGACTACCGCAAGCTGCGCAGCGACTACCGGCCCTGGTTCCCGGCACGGCAGCTGTACGGCGAGGGCTATGCCG
GGCTGGGCAACGGGTACACAGAGGTCAACGGCCCGTCGCGAATCCTGTATCCGATGCAAAAAACGCGTCCGGGCAAACGG
CAAACACCGGCGCTCAAGTACAGCCGCAAGGACATGGCGCAGCAGGCCGAGCAGCACGAAGAGCTGGTGCCGATTCGGCT
CGACGTCGAGTGGGACAAGATCAAGCTGCGCGACACGTTCACGTGGAACTTGCACGACCGCTTGGTGGCGCCCGAGCTGT
TCACGACGCAGCTGATGGAGGATCTCGGGCTTCGGCCGCCCGCCGCGACACAGGTCTACGAGCAGATCAGCCAGCAGATC
CACGAGCAGCTGACCGACTTCTACCCGCTCGTCTGCTCGGACGAGGACGCGCTCGACCCCGAACTGCCCTACTCGGCCTA
CAAAAACGACGAGATGCGCATTCTAGTCAAGCTGAACATCACCATCGGCCAGCACACGCTCGTCGACCAGTTCGAGTGGG
AGATCAACAACCCGATGAATTCGCCCGAGGAGTTTGCTGCCGGCATGGCCCGTGACCTCTCGCTCTCGGGCGAGTTCACC
ACCGCCATCGCCCACTGCATCCGCGAGCAGGCCCAGCTCTTCACCCGCGGACTCTACAGCGTTGGCCACGCCTTTGACGG
CCGTCCGGTCGAAGACCCCGATCTCGTCGCTGCCTTCTTACCCTCGCCCCTGCCGGCCGTCTTCCGGCCCCAGCAGCAGG
CCAAGGAATACGCCCCGTACCTGTACGAGCTGAGCGAGGCTGAGCTGGAGCGCAACGAGCTCACCTTTTCGCGCGAGCAG
CGGCGCCAGAAACGCTCTGTCAACCGGAGGGGCGGGCCCATCTTGCCCGATCTCAAGGACCGCCAGCGCACCATCCGCAC
TCTGATCGTGTCGTCCGTGCTGCCGGGTGCTGCCGCCGACGTCGACGAGAGCCGCCTGTACAAACGTGCAGCCGGCGCTT
CCGGTCGTCGTCGTGGTGGCCGAGACGGCGACCTGCTCTCGGACTCGGACGAAAGCGACGACTCTTCGCCCGATTCGCCC
TCCACGTCCCAGCACTTTGGCTCTTCCAACACCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCAATGCGCGCACCCGTGG
CATCCGAGGTGCTGCCACTGCTGCCCAGCAGCGCATGGCTGTCATCGGCCGCTCCGAGACCCCCGAGGCCAGCACCATTC
ATCACCACGAGACCCGCACTGCTCGTCGCACTACCCGCGATCTCCGCGACGACTCGGTCGACGAGCCTGCTCGCCTCATC
GTCACCATCCGCGTCTCCAAGGACCGTCTGCGCAAGCTCATGCGGGATCTTCGCGCCAGACCGCCGCCTGGTGGCACTCC
CTCGCTCGCTCCGCTTACTCCGTCCCTCCAGCAGCTGCAGCAGCCCCTCTCTCACGCACATCAGCAGCTGCAGCTGCAGC
AACAGCTGGCAACACCCATGGGCCCGCCACCAACCACTCCGTCAGGCCGCCACGCTGCAGCTCCATCGCGATCCGCCATT
CCCCATGGCCATCTGGGCCGTCTCCCAGCAGCGCCACCACCTGCATCAGAAGCGGATGCACCACCAGCAGTATGTCTGTT
TCTTTGTTGTTCTTTTTCACACTCGTTTTCTTCTTTCTTTCTCTTATTCTCTACTGTTACCCACCCCCGCTAACACCCCT
AGCCACCCCCTCCACAGTGGCTCCTCGACGCCCTACAGCGCCTGCGCGACCGCGCATATCCCAACGACTCCTTCGAGGGC
GTCATGCGCTACAGTGTCTTCAACCGCGAAGAGCAGCTGGTACCGGCGCCGCGGCTGGGCGAACCGCTCGAGAACTACAG
GTTCTGGTATCTCCCGCGCATCCGCTGCCACGACTGTCCCGGCAAGCTGTACACGCCCGGCCCCGAGATGACGGTCGGCA
ACTTCGAGGTCCATCTGAAGAACCGGTTCCATCGCGAAAAGGTCGAGCAGCGCCTCGTTCGCGATGCCAGCAGACAGCCG
TCCGGCCAGCAGACAGCCACCTCGACCGCCTCCAACGTCCCGCCGCCACCGTTGTCGTCGGGTCGCAGTGCCAGCGGAAC
CGCCTCGCCAGCCCCAATTCAGCATCAGAACTTCCCATCCGCCCCGACACAGCCGCTGCTGCTGCAACAACAACATCAAC
ACCAACAACAACAACAACAACAACTGCAACAGCAGCAGCAACATCAGCAGTCCGCCTTCTCGCCCGCTCCTCTTCAGCCA
CAGCAGTCCTTGTCGCCCTCCGTGGCCGCCGAGGACGATTACGACGACGCGTCCATGGCCTCGTCATCACCCGCCGAGTC
CGCCTCCGAAGCCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62