GenePrediction:GLEAN_1164 Details

Name: GLEAN_1164
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1013976..1017179 (+ strand)
Length: 3204
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1013976..1014368 (+ strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_173:1015236..1016743 (+ strand)
Length: 1508
Type: CDS
Source: GLEAN
Position: GCSC_173:1016807..1017179 (+ strand)
Length: 373
>GLEAN_1164 class=GenePrediction position=GCSC_173:1013976..1017179 (+ strand)
ATGGCTCCAACCGTGGCCGAGTCCTGGCCGGAAGCTATTCTCGGACAGCTTCAGCTGTGGTACGGACTCGTATCGTTGGT
GGTGTTTGTATCGTCTATCGCGTTGCACAGCGTATGGGATGTTCGCCGTGGCGCGGAACTCATCCCACCAATGGTAACCG
GTCCCGGCGGGCGACCATTGCCTGCGACACGCCGCAAGTCCCAGGACACGTCGAGCGTCGCATTTACGCCCAATCTGGAA
ATCAGCAGGCATATTAGGCGACTATACTGTTACGCCAGCTCCAGCGTCGGACTTTCTTTTTTAGCCAACTTTATCAGCGT
CATCGCACACACTCTTGAGGAATCAAGGAATCTCGATACCAAATACAGCTGGTGGTGTGGTGAAGAGACTTCCGTATGTC
GACAGCTTTGTTCTGCCTCCCCCACTGCCACCCGTCGTAGAGTTCGCTTGCTATTTCGCGTTTCTCAGTTCCGGTTACTT
ATTATTCTAGGTGTACCTCATATCGGGCATATTCATGCACCTTTATGTCTTTGTCTATCTTCTGGAAGCCGACAGAGTCC
CAAACAAGCCGGTGGCCACTTTCTGGACTCTCTCACTCGCTGAAGAAATTGCCATTTATACTACCAACGTCATTCGTGTC
ACTGGTCGCCATCAAGTTCTACGAAGCGTCGTGCACGATATTTGGACTACCGCCTATGGTCCGGATCGGTGGGATTATAT
CGACATAATCATCGGCTCCATTCGTATAGCTCTCCTTGTACTCCTCCTTTCCGTCTATACTTCTGTCTCCCTTTCCCGAA
ACACCAAAACCCCAAGGAGAAGCTAGAACGGGATGGACGACTGACGGACGAGACAAGTGAGGACGACGAAACCACTCCAC
TTGTCCGAAGAAGAGATGTGACATCCTACAGCGCTGTTACCAAAGCAGTCGGCAATCATGTCAATGGGTCTCCGAAAAGC
ACAATTATTGATGCTGTCACTGATGCTCCCAGCGACTTTCCTACAGCCTCTAGCAAAGTCTCTGTCAGAGACTGTCCCAA
CAATCCTACTGATGGAAGTTCTACTGCTTCAACTGGCAAAGGACATGAAAGCGACACCGACCATGAAGAAGTAGCGTTCT
ATCGACCGCACAAACTTCCCCACAAGACATGGTGGGAGTATGTCACAAGCTACTCGCTCTTTTTCCCTTACCTCTGGCCA
AGCGACTCTACGAGACTACGATTCGTAGTAGTCATCTGTTTCTTCATTTTGATTATTCAGCGGGTGGTCAACTTTCTTGT
TCCAAACCAGATCGGAAACATCACTGATGCGTTTGAATCGAAGAACGGACTGCCTTGGCTAGAGATTCTGACCCTGATCT
TCTACAAAGTCTTGCAAGGTCAGGGTGGCCTACTAGGGTCTGTAAGGTCTCTCATCTGGATCCCAGTCTCTCAGTACTCC
TACCGTGCTCTCACAACTGCAGCTTTCGAGCATGTTCATTCGCTCTCGCTGGATTTTCATCTCGGCAAGCGTACGGGTGA
AGTTCTATCTGCACTAAACAAGGGTGCTGCCATCAACTCCTTTTTGGAGCAGGTCACATTTCAGGTTTTCCCGATGCTGG
TCGATCTTCTCGTTGCCATCGTCTACTTCCTTTTCCGATTTGGCGCCATATATGCTACCATTGCTGCCGTCATCACTGTC
TATTACCTACATATGACTGTCAAGATGGCATCGACCCGTGCAGATTTGCGGCGAGATATGGTTAACGCTGACCGCGAAGA
AGAAGCTGTGAAGAACGATTCCATAACCAGTTACGAAACAGTCAAATATTTCAACGCAGAGGCTTTTGAGTTCAACCGCT
ATCGCAACGCTATCAAGAGCTTCCAAGTCGCAGAAGCCAAGGTGACATGGGGCATGAACAACATGAACATTTGTCAGGCA
CTTGTTTTCATGTGTGGCATTCTGGTCATGCTCATGGTCGCAGCTGTCGAGGTCAACCAGGGAATGCGATCTGTGGGTGA
TTTTGTCGTTATGACCACCTATTTGGGCCAGTTGCAAGGCCCGCTCAATTTTTTTGGCTCGTTCTATCGGACAGTCCAGC
AAGCCATGATTTCTGGCGAGCGTCTTTTAGAACTCTTCAAGATCCGGCCAACCGTGGTAGATCGCCCAGGCGTCAAGACC
CTGTCGCAGTGCCGCGGCCATATCCGATGGACGAACGTCAAGTTCTGGTACGATGCAAAACGCACTGCTCTTCGCGACCT
CTCTTTTGACTGCTGGCCTGGGACTACGACGGCTTTTGTTGGCGAGTCGGGAGGTGGCAAGTCGACAATTTTCCGGCTCA
TGTTTCGCTACTATAATTGCCAAGGAGGCTACATCGAAATTGACGGCAACAACGTTGAAGATGTCACGATCGACTCGGTG
AGACGTCACATCGGTGTTGTGCCACAGGACACAATTTTGTTCAATGAGACGATCATGTATAACCTCAAGTACGCCAATCC
CAGCGCATCAAATGAAGAAGTTTTCGACGCCTGCAGGGCTGCAAGCATTCACGACCGGATCCTATCATTTCCCTACGGCT
ATAATACAAGAGTCGGAGACCGTGGCACCCGGCTGAGTGGCGGTGAGAAGCAACGCGTGGCAATTGCTCGCACCATTCTC
AAGAACCCCAAGATCATCATGCTGGACGAAGCCACCTCCGCTCTTGACAGTGAGACCGAGCAGCAGATCCAGGCGAAATT
GATCCGTGGCGGTAGCCTGGGCCAAGATCGTACTCTCCTGATCATTGCGTACGTGGATTCCATTGCAATGTTCTTGCAGT
TACCATACCAGCTGACTAACATGTTGAACAGTCACCGGTTGTCAACCATTACACACGCGGACCAAATTATCGTGCTCCAT
GCCGGGGGCATTGTCGAGAGGGGCACACACAATGAGCTGCTGGAGCTGAGAGGCCGGTACGCGTCTATGTGGGAGAAGCA
GTCTCAGGCGGAGCAGGCTGCAGTTGCGGCTCGCGACGCAACGGTACGGGCGAATCAGCTTCTGCGCCAGGCACACATCA
GTAACAGCCCTATACAACGTCGCGGTGGTGATGAAAATTCGGATGGCTATACTAGTCTGTCATCATCAACCGTCCTTGCG
ACTGGGACGACGACACCGAGACAAGGAAGCATCGCACGGTCCCCAGATTCCTCAGATGACGACCAACGCCCTCCAGCACA
TTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62