GenePrediction:GLEAN_1166 Details

Name: GLEAN_1166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1042212..1044146 (+ strand)
Length: 1935
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1042212..1042281 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:1042339..1044146 (+ strand)
Length: 1808
>GLEAN_1166 class=GenePrediction position=GCSC_173:1042212..1044146 (+ strand)
ATGGCCGGCTCCCGCTTTATGATGCACACCAAGAAGAGCCCAAAGCAACAGACAATTATAGCCATGCTTGGTACAGAGGC
ATACACCCATCAATATATTGTTTTCTGAGGCATAACTGACTGCCCAGGGAAACCACTGCCTGGCACCCAGCTGGGGTCAG
ATGCCTCGAGTGCGGCAATCAACGTCAGCAACGATAGCAGCGATGATGATGATGACCTGCCTATCCGTAGCCGCAGACGC
CGGACCAGTAATACTATTCATTGGTCGGACAACCACCCGGCAGAAGACGCACCGTCTCCATACTGCTTGTCAACCTCAAA
AATCGTTGCAAGATCGTCACCGGGTCCTAGCACAGCCAGGAAGAGGACAGTCCTCAGCTCCGATAACGAGAGCTCGGGTG
GTACGATAGAGGCAGAGGGAGACAAGCCTTCATCGTCGACTTTGCCGAGCCGCCCTGCGAACGGCATCATCGTTCTTAGC
GATGATAGCGACAGTGATGAAGACATTCGTCCTGCGAAAAGAAGGCGTCGGAGTTTGAAACAAAGCAGTCCCCATGACAG
CGATCGAAACGATGCTGGTAGCGACGACGCTGGCCAGGCCGTGGTAACTCCCCCTCGAGCCAAGCAGTCGAGCCCTGTCA
ACCGTGCGGCAGGATCACGGTCTGCACGAAAAAGTGCACGCTCTGTGCGCCAGCGACATATGGAGCTTCTACGGCGACGG
AAAAGGGGAGAAAAGGTGACAGAGAGCGATTTGGCAACCGAGTCTTCGGATGAAGAAGCCCAGGTGGCTCTTTACGACAC
CGATCCGGAGCACGATGCTTTGTCTGAGTTTGAAGACGAGGAGGAGGGGGAACAAGCCGATGTCGCGACGCCCAGTAGGG
CAGCGAAGCCGAAGCAAAAGGGCAAGGGGAAAGACAAGCAGAAGGACAAGCAGAAGGAAAGGGGCAAAAGGAGAAAAGAG
CCTGCAGTGGGGGAACTAGGTCGCGCTTACGACAGCGATTCCGAGAACATACTGAGTCCACTACAGCAGCAGGAAGACGA
AAGCGAGGAGGACGATGAAGACTTTATCGATGACAGCCATGTTGGGCTCATCGGCGAGCCGGACGAGGAGATGTTGCGTC
GTGAGATGCCTTTACAGTTCACGTCGCAGTCGCGGCAGCCGCTGAAGAACCACTTCAAAGACGCGATCGAATGGCTCGTG
CATCGACGCATCGACCGGGGTGGCGCACAAAACGACGACGAGATATACCGGCTAGCCTGGGACCGGCTAGACCGCGAGCT
GGGCGGGCGGGCGCAGTCGCGGTTCATTTCGTCGAGCTGGACGCCGGCGTTCCGCGGTGCGTTGCAGGCGAGGCCTTACA
TGGACAGCTACAATTTGAGGCCGGGAAAGTATTCTGGCGGTACTGAAGGCAGCCTCACTTCCGATACGGACGTCTGCCAC
GCCTGTGGCCGCAGCAACCACCCGGCTTCGTACATGGTCCTTTTCAGCGGGCCGGTCTACGACCTGAACACGCTGGACGA
TGTGGACGACGGCGGGGATGAAGATGGAGAGGGCGAGGGCAACGGCGAGGAGGATGAAGAGCCTGTGGACATGCACGGGA
ACCCGATTGCGCCGGTGTCGCAGCGTTGGCTTGTTGGAGGCGTTTGCCACAGCAACGCGGAGACAGCGCACGATCTGCTG
CACTGGAAGCGGGCACTGAAGGACTGGGTGGACGAGAAACTGAAGGAGGACGGGCAGCTGGAGCCGCAGCGGCTTCAGGA
GCGCGACGAGATGAAGCCGCGGAGGCGCCGCGTGCTGGTGCACAGCATTGTCGACGGGTGGCTGGCGGCCGGGACGATCA
ACGAGCTATACGGCGACTTTGTCAAGTTGTTGGATGGCGCACGGGCGAAATCGACCAAGACGGTGCGGTTTGGGCGCAGT
AATGTTCGTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62