GenePrediction:GLEAN_1167 Details

Name: GLEAN_1167
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1045964..1047571 (+ strand)
Length: 1608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1045964..1046237 (+ strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_173:1046296..1046457 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_173:1046514..1047571 (+ strand)
Length: 1058
>GLEAN_1167 class=GenePrediction position=GCSC_173:1045964..1047571 (+ strand)
ATGAGCTTCCAACAGGGCACCGCCTATGCCGAGTCGGACGCTGATGACGAGTACGAGCGCGACCTTCACGACAGCTCACC
GATCGACGTGACGGAGTCCGAAATCTCTCCCACCGAAACAGACCCGCTGTCGGCTGAACACACACCTACCACCTACGGCT
ATCGCAGCAGTGTCGACCGCCTGCCCGAGACCAACATCACCGAGTGGACGGCAGAGGAGTGTGCCGACTTCATTGCCACA
ATCGGCCTGCCGCAGTACACGGATGGCTTTCTGGGTAAGCCACCGCCGCGGTCGAGTCTACGACTGGCCACCGCTTTTGC
TGACGCGCTTAGAAAATGAAATCGTCGGAGAGGCCCTCGTGGCCTTGCAGCATGACGATCTCAAGCAGATGGGAATCGCC
AGTGTTGGGCACAGACTGACCATCCTCAAGAGCGTCTACGAGGTCAAGAAGGCGCAGGACATATCCATAGAAAGCGATCA
CTATGTCCCTCTGAGTAAGAGCTTTCCCGCTCGTACGGCCCTGCTCTGGCAGATACTAATGGACGCACAGCTGCCGAGAA
CGAGGCTCAATCAACCATGGCCACGCTCAAAGACATTAAGAATCTGGTCGAGCAGCTCCGCCTGCGAGACGAGCGTATGG
CGTTATTTGAGCAGGACCTTCGACGGCTGACGGACGACTTCCGCCGCCTACGCGAGGACGTCCTGCCTGCTCTGCGCCTC
GCGAAGGATGCTCAACATCCGCTTCCACAGGTGAACAACGACCAGCCCTACAGCTTCGAGACGGTCATATCTCCCCCGCC
AGGGCCATCACAGCAGTCGACTATCCAGTCGATCAACATCAAGCGGCAATACTCGACGCGGAAGGTGGTGCCAGCAGCGA
CGCCGAAGACAGCATCTCCCACGCATTTGCAAACTGCTCACGACCGGACGATCGTCGATCAGACACTCGACCCAGCCAAC
GCCGCCGAGCGTGCTGTCTTGTCATCTCAGCACCTCGCGGCCTCGAACGGAGGCGGCGGCCAGACGGCCTCGGCCCTCTC
GCCCTCTTCCCTGTCTCCCAATATGCCTTCTCCCACGTCACCACCCATGTCGACAAACGGAACGACGCTTGCCTCCCGCT
CTTACCGCTCTGACCAGCCGACACCCTCTGGCAGGACCACCTTTTCCGAGAGCGAACACAATTTCGCAGGCTCGTCCCGC
GATAACCGACATACTGCCACTGCTCCTCGGCGGAACCAAACACCTGCGCCCGACACCCCCGGAAGCAACGCATCTGTCGA
GATCTTCAAGTCATTCCGTGTCAGCATGGATGACCCGTGCTACAAGGTGCTACCGGCCGCTTTACGGCGCTACCAGATCA
ACGCGCCGTGGGACCAGTATGCACTATATATCGTGTACGGAGACCAAGAGCGCTGTCTGGCCTTGAACGAAAAGCCACTC
ATCCTGTTCAAGCAGCTGGATAAGGAGGGCAAGAAGCCGATGTTCATGCTGAGAAAGACAGCAAACGCGCAGGTCGACCT
CCCGACGGACATACCTGGAAGTGCCGGCCTAAATGCTGCGGCCCGCGGCGCTTCAACGGGCTATGATCCGCCGGGTGGTA
TCATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62