GenePrediction:GLEAN_1168 Details

Name: GLEAN_1168
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1048576..1051451 (+ strand)
Length: 2876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1048576..1048653 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_173:1051179..1051451 (+ strand)
Length: 273
>GLEAN_1168 class=GenePrediction position=GCSC_173:1048576..1051451 (+ strand)
ATGGCCGGCAGTTGGCGGAGGTGGAGGCGGTGGAGGGGGAAGAGAGGCGTCTGGGCTTGGGACGGCATCTGGGCGACGGT
CTGACGGCAGATCCTGACCCTCGACGCCGTACATCTTGCGCAGCCGTTCGGTCTCCTTGGCGATTTCGGCCTCACGCTGT
CGCTGCTCCTTCTCCTCGGCCTCGAGCATCATTTTGATGCGCTTTTCCTCCTCGCGAAGACGGCGGTCTCTCTCACGCTC
CTCGCGCTCCAGCAGGGCCTGCAGGCGTTTTGTCTCGGCGTCGATGGCGGCGGCAGAGGGTGTAGCGGCAGCCGTGGCAG
CGGCAGAAGAAGAGGCAGGAATCGTGGATGCCCGTCCGGGTGGTGGAGCCGGGTCTCGCGAGTCCTGACGGCGGACAACA
GCAGCAGTAGAAGCAGCAGCAGCAGCAGCAGCACCCTCGAGGTTGAAGGGGTCGGAGCGGGGGACGAGGTAGAGGTCGCG
AATGACCTCAGCGCCGAGCAGGAGGAGCAGCTCGAGGCCTTTGCGGTCCTGAACGTCGACGCGGTGCAGGTTGGGCTCGT
AGATGGTCAGGGCACGGTCGCGGCCGTGCTTGAAGAGGGCAATGGTGATGTCAGGCTCCTTGTTACCGCGATGATAGGCG
GCATTAGTCTTTCCGACGAGGTAGCAAGTCATGTCCTTGTTGCCGAGACGGCCATCGCGCTTCCAGCGAAAGGTGGAGCG
CGGCACGAGGGCAGCGGCTGTGGAGGCCGGACCGGGCGTCGAGGATGCGGTAGAGGAAGACGGCGCGGTGCTGCTGCTAG
CAGGCTCGCGGTCGAGGCGGCTGGCACTGGGCAGACGGAAGCTCTGGATGGGCACGTCAAACTCCCACGAGTCGGTCTTG
TTCCAGCCGCCAGGGTTCCAGCGAAAGACGACCGCCTGATCGGGGTTGTACAGCTGGACGGAGAAGGAGTCAGGCACCTT
GGCGATAGGGGCTGCAGCTGTGGAGAAGGAGGTGGTGGCGGACGTCGTCGTCGGGTCGCTGCCCTGGCGGCCACGCAGAT
CGCGCAGCTCGGCGGCCGACAGCACGGGCTGCTGCCACTGAGGGCTGACGGCGACCTCGCCGTAGACGACGTCGCCGCAG
TTGTAGGGGTCGGTGAGAGCGGCGGCATAGAGGCCACGGCAAGCCGGTTTGGAGATGGGATCGGCCAGACGGAGGACGTA
TTCGGGCGTCGGGTCAGAGCCGCTGCGGGTGAAGTAGACGACGGCGCTGCTGGGAGTATCCGGCATGGGCCGGAAGAGAA
AGGTCGGGAGGTTTTCGTCGAGCATTGTGGGGGGTGTGGGATGGAGGTGGAGGTAAGAAGGAGGGTGAGAAGGAGAGGAT
GTTACGAGACAGGAGAGCGCGATAATGGGAGGGGAGAAAGGAGAGAAAGGAGAGAAAGGAGAAGCGACAGAGAAGGAAGA
ACAGAGACGAAAGAACGAGGAGTAGAGAACGAACGAGACGAGAGAACGAAGAGTAGAAAACAGCAAAGAGCGAGGATAAA
TTACTGACAAAAACACTACTATGTAGGCACCAGCGTTCCTTCCTTATTCCTTCCCACAGCGTCAGCAGGCCTCCTCGTCC
AAGCCAAGCAACTGGAATGCCTGCGTACGTAAGGATCCGACTGCGCCTACGAGAAGAGACAGGCCTGCCACCGCCGCCCG
CTGATTGGGCCGCACCCCTTGCAGGAGGGCTGTGCTGCACGTAAGCACGACTGTTCACGCGGGGTCCCGCCTTGTCGCCC
CAGCAGGCAGGCGCAACCGGCGGAGCAGAGCAGCACAGTATATTCGATCATCATTTATACAGTACATACGATACGAAGGA
GTCATATTCCCCATCTATCACGCAGGCTGTTCGCAGCACACAAACAAGAGAGAGAGAAACAAAAGAAAAAAAAGGAGGAG
ACAGGAACGCCTAGACTAGCGGACCAGCCGAAAAATCAGAATATCTCTCGAGCCCAGTCAGCTCTCGACCAGTCATCTAT
ACCGGCGACCCGCCGTTGCCCCGGCCGTTGCCACCGTCCAGCAGCAGCTTCGGCTTGATATAGTCCTCGTCAAGCTGCTG
CAGCAGCGCAGACGCGTCCTCTGTGCTGAACAGCTGCCGGAAAGCCGCCGAGGCCGTCATGCCCCCTGCAGCAGCACCAC
CACTGCTGCCGCTGCTGCTGTCACCTGCACCGGGCCCCCTGGTCTGTCCTGGCGGCAACGGACTCGGCCGTCTCCACGGC
GCCGGCGGTGGCAAGTCGGACGTGTCAATGTCGCTGCCCACCTCTGAGTTGGTCGCGCTGGCTGCGGTGCCCAGCAGCTC
GGCCTGTTCGGCCGCGTCGAGATCGCGCAGCGAGTTCTTCCGGCTCAGACTCGACGGCCGCTCCACGATTCCGCTGCTGC
CGTTTGCTAGTCCAGGATGCGATGGTCGCATGCCTGTCGTCCAGCTGTTGTTGTTTCCACCATCACCACCACCGCCACCA
CCACCTCCATCTCTGCTGCCACCCCTGCTGTTGCTGCCGTTTGCGTGTCGTCCAATCCGGTCCAACGGCATCGACGAGCT
CGCAGCCGCTCCACCGACGCCGGCAACACGCGTTGGATCGTAGCCAAAGCCGCTGCCCGACTGCTTTGCATATGCGCCGT
TGCCGATCGGCTCAATGTCAAACTCGTCGTCCGAGTCCATCTCGTCCACCACACCCGTTCGGATGCCCAGAATCTCTAGC
ATCCGCGCCGTCGTTCCGCCAAAGATGATCACCGTCAGCACCACCACCACCAGCACCGTCGCCTTGAGCGCATATGTGTC
CTTGCCCGTCAGCAGCGCCGCCAGCGCCACGCCCACCGCTCCGCGCAGCCCGGCCCAGAAGAGCATCGCCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62