GenePrediction:GLEAN_1169 Details

Name: GLEAN_1169
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1053565..1054914 (+ strand)
Length: 1350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1053565..1053737 (+ strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_173:1053864..1054914 (+ strand)
Length: 1051
>GLEAN_1169 class=GenePrediction position=GCSC_173:1053565..1054914 (+ strand)
ATGGCGAACAAGCTGGAGCGCATCGACGCGCCCGGCATTCGCGCCGAGGGCGCCGTGCTGCACAACATGCGCCGTGAGGT
CGCCAACCTGCTGCATCGCCAGCAGCTGGGCTTTCCGGGAGCCCAACCCGTGAGCTTCTCGCGCAGGCACATGGACGAGC
TTCGGAAGCAGGAGTACGTTCACCTTGGCTCGTGTTTTCTTCTTCTCCCATTCTTCCCTTCTGTCCTTGAGTTCTTTCTC
CCATGCTCTCCCCTACTCTCTTGTCTCCCCTCTCTCCTCGCCCCCAGCTAATCCCACAGCTACTATGTCTGCGAAAAGAC
AGACGGCATCCGCTACCTGCTCTACCTGACCGAAGACGAGGGAGCAAACGAGGTGCAGTACTTGATCGACCGCAAGAACG
ACTACTGGTTCCTACCACCAGGATCGCTGCATCTGCCACGCCCCGACGACGCGGCCGGCTTCCACGTCAAGACGCTCGTC
GACGGCGAGCTGGTCGTCGACGATCTCGGCCATGGCAACACCCAGCCCAACTTTCTCGTCTTCGACTGCCTCATCCTCGA
CAACAAGGACCTGACCGAACGCACGCTCGACAAGCGCCTGGGCTACTTTAAGGAAGCCGTCTTCAAGCCGTACCAAGCGC
TCTTCCGCAAATATCCCGAGGAGCGTCAGTTTCAGGCCTTTGGCATCGAGATGAAGAACATGCAGTACAGCTACGGCATC
GAGATGATGTTCCGCACCGTCCTGCCCAACCTCAAGCACAGCAACGACGGCCTCATCTTCACCCGCTGCAACACCGCCTA
CCACTCCGGCACCGATCCCCACATCCTCAAGTGGAAGCCCGTCGCCGAGAACACCATCGACTTCCGCATCGAGCTGACCT
TTCCCCCGCGCGCCACCGCCATTAAGAGCGACGTCGACGACGGTGACGACGACAGCGGTACCATCAACAGCGGCAGCAGC
AGCAGCGCCCACGACCTCAGCTTCCCCGACCTCGACTACGATGCCCTCCCGACCGCCAACTTGCTCGCCTACCACGGCGA
CAGCGACCCCGAGCCCTACCAACTCTTCAAGTCCATGTACCTCACCGCTGACGAGTGGGACGCCATCCGGTCCACCGGCG
ACCCCGTCTCTAATCGCGTCGTCGAGTGCGCCCTCGACGACCAGCAGCGCTGGCGCATCCACCGCTTCCGTGACGACAAG
CCCGAGGCCAACCACATCAGCACCGTCAAGAGCGTCCTCGAAAGCATCCGCGATAGCGTCTCTGAAGAGGAACTCATGGA
CGCTGCCAAGAGCTTCAAGGAGGGTTGGCGCGCCCGTCAGCAGACGCAGCACGAACAACCACGACGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62