GenePrediction:GLEAN_1170 Details

Name: GLEAN_1170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1058581..1064534 (+ strand)
Length: 5954
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1058581..1062651 (+ strand)
Length: 4071
Type: CDS
Source: GLEAN
Position: GCSC_173:1062714..1063080 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_173:1063357..1063405 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:1063629..1063700 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:1063760..1064534 (+ strand)
Length: 775
>GLEAN_1170 class=GenePrediction position=GCSC_173:1058581..1064534 (+ strand)
ATGGCTCCTGCTCGCCGACGCGCGGCGGCCAAGAACGGGGTGGCTGCCAAGGAGACCGAGGTACCAGCACCAGAAAGCAC
AACCAGGGCATCACGCCAGGCTGCCGCAGGCCGAGGACAGAGAAGGACACAGAAGAGCGGCGGCCGTGGCCAGGCCGAGC
CCGAGTCGGAGACCTTGGCAGAGCCAGAAGAACAGGCAGAGGAGGAAGAGGGAGAAGAGGGAGAAGAAGAAGCAGCAGAC
AGAGTAGAAGAGGAGGCAACCGCAGAAGCAACAACAGGCCAGGGCGACAGGCCTGTCGTGCTGAGCTTCAGCGAGCCTCT
CTCATGGCGGCCGGGGAAACCGATCGCGACGGAGGAGCTGATCCGTCGGCTCGATGCTCTCAGCCGCGAGCTCTCGGATC
TCGACCAGGAGACGTTCGATGCCGAGTCTCTGACCAAGGTGTCGAAGGAGCTGGCAAACCACAACCTCCTCAACCACAAG
GACAAGGGCGTCAAGGCGTTTGCGGCGGCGTGTCTGGTAGACATCCTGTGCCTCTGTGCACCGAACGCGCCCTTTACCCA
GACACAGCTGCAGGACGTGTTTGGGCTCTTTATATACTCGATCTTGCCGGCGTTGCAGGACCCGTCGAACACGTACGATG
CGCAACACAAGTACGTGCTGCACTCGCTGTCGGAGGTGCGCAGCATCGTGCTGCTAAACGACCTCGACAACAGCGACGCG
CTGCAGCTGCAGCTGTTTTCGTCGCTCTTCGACGCGGTGTCGGCGCCCAAGAATGTGACGGGGGGCCGCCTTCCGACGGA
CGTGGAACACGACATCAGCGACATTCTGATCTGTCTGATCGAGGAGGGCTCCAGTGTGCCGCCCAAGGTGGTAGACGTGA
TCATGGCCCAGTTCCTGCGAGCGGCAGCACCAGGAGTTCTTCGCGAAAAGGGCGTGCCGGACAAGGAGGAGCTGGACCGG
TACCAGTCAACGCTGCTGCTAAAGGAGGAGCCACCGGCATACCAGATCGCGAAGCTGATCTGCCTGACGTGCGCGGACAA
GATGACGCGTTCGGTGGCGCAGTACTTTAGCGACGTGATCATCGACTTCTCGGGTGTGGGAGGCGGCAACGGCGGGCCTG
GAGCCGGTGGCAACCGGGCAAACGGACACAAGGGCGGCAAGGAGTCGGACGAGGAGGCGGAGGAGGACGAGGGCTTGAAT
GGGCCGTCGGACGCGGACCTGCGCGAGATGCGCAAGGCCCATCTGCTGCTGCGCGAGCTATGGCGGGCAGCGCCGCAGGT
GCTCAGCAACGTGGTGCCACAGCTGGAGGCGGAGCTGTCAGCCGACAATGTGTACCTGCGCAAGCTGGCTTCGGAAACAC
TGGGCGACATGATCTCGGGGATCGGGGCAGCGGGACCGCCGGCGCCGCCGACGTTGGACCCGGCGGCATATCCGGCCCCA
CGACTCTCGGACGAGCCGACAGCACGGGCATCGGACAGCGTGCTGACGACGCCGACGTCGCCGCACTCGTTTGCGCAGAC
GCATGCGCACATCTACCAGAGCTTCATCAACCGCAAGAACGACAAGTCGGGGCTGATCCGCACGGCGTGGGTGACGGCGG
CAGGCTATATCCTGTCGACGTCTGCAGGCGGGATTGGGCTCAGCCGCGAGGAGGAGACAGCGCTGGTGCTGGGGCTGGGT
GACAAGCTCAACGACAGCGACGAGAAGGTGCGGCTGGCGGCGGTGAAGGCGATTGAGTGCTTTAGCTTCCGCGACGTGAT
GACGAAGCTGGCGCCGCACGGCGGCGTGTCGAAAGAGGGTTCGGTGTTGGCGAACCTGGCCGATCGCGGACGCGACCGCA
AATCGCATGTGCGGGTGGAGGCTATGGCGCTGTTGGGAAAGCTCTGGGCAGCGGCGACAGGCGAGCTGGCAGCGGGCGAC
GAGGCGGTCACGACGGCTCTGGGGGCGGTGCCGTCGCGCATCTTCAACGCGATCTACGCCAACGACCTGGAGCTCAACCT
GCTGGTGGACCGGATCGCGTACGAGTACCTGGTGCCGCTGTCGTATCCGGCGGTCAAGAAGGCGGCCAAGGCAGCCAACG
GGCGATCACACCAGCAGAAGGCGGCAGTGTCATCGGCGTCGGGCAGCGGCGTGGACGGAGACGCGCTGCGGGCGGAGCGG
ATTCTTCTGCTGGTGCGGTCGCTGGACGCGGGGGCCAAACGGGCGTTTTTTGCGCTGCAGAGCCGACAGCCACAGTTCTC
CCGCATCGTGGACGGGTTCCTGAAGCAGTGCGAAGCCTACAACGGCGGCGTGGGGGAAGACGGACGCAAGGCCGGGCCTG
GACTCGAGAAGAGCATGCAGTACCTGGCGCAATTCTTCCCGGACGGACCCAAGGTCAAGGCCGACCTGCAGAAGTTCGCC
CGGCTCAACGACCGGCGCAGCTACCAGCTGATCCGCTTTGTGACCGGGCCAGAGCACGACTTCACGACCATGTACCGGGC
GATGAAGGAGCTGGTCAAGAAGCTGCAGGCGGTCGGGGCGGGCGGGGTGCTGGACACGCTGCTACCACTGCTGTACCGGT
CGGGCTGCATCATGTTCAACCGCAGTCACCTGACGACGATTCTGGAGTGTTCCAAGGGCGGACAGGCTGAGCTGGCAGCT
ACGGCTAACGAGATGCTGAAGGAGGTGTCGCAGCGCAACCCGGGGCTGTTCAAGACGACGATCGGCGAGCTGTGCAAGGA
GCTGACCACACAGGCGCCGACGGAGACGCGCGAGAACGACCCAGTGGTGATGGACTCGCTCAAGGCGTGTGCCTCGTACG
CGGCCAAGTATCCGCAGGAGGTGCCGCGGGAGCGCACGTTTGCGCAGGCGTGGATCAGCTTTGCGCTGTACGGGCGGCCG
GAAAAGGCGGCCAAGTATGCGGTCAACATCCTGCTGGCGACGCGGGACGAGACGAGCATGGTCAGCGCGACGGAGCTGGC
GCAGAAGGCGACGTGCGATCTGGGCTTTGATGGGCCGCGATTCCTCAACAAGCTGGTGACGCTTAGTCAGCTGGCACGAC
TAGCGCCGGCCGTGATTGCAGACACCGAAGACGACGTGCGCAAGCTGGTTATGGACACGCTGCGCAACGTGCGGACAGCA
GCAAGCGCGGGCGACCCAGCTTGGGCGAGTGATGCAGAGCTGGACGAGGAGGGCCGGGCCAAGGTGTTGTGTCTGCGGTT
CCTGGTGCAGCAGCTGCTGGGGACGGAGGATGGTGAGGAGGCCAAGAAGGACGGACGCCACATTCTGCGGCTGCTGATCC
GTTTTGTGGCCAAGGATGGTGAGGCGTCGCGGACGGGCGAGACGCCAGCACACCATCGAGCACGGCTCCGGCTGGCGGCT
GCCCAGGCGGTCCTCAAGATCTGTGCCAACCGGCAGTTTGACGAGCTGCTGTCGCCGGCCGACTTTAACGCGCTGGCGCT
GACGACGCAGGACCCGGCGCCCGAGGTGCGGCACGGCTTCATCGAGAAGCTGCAAAAGTACCTGGTGCTGGGCCGGCTGC
GGCCGCGCTTCTACACCATCGTCTTCCTGGCAGCCTTTGAGCCCAACGCTGAGTTCCGACACCAGGTCGAGACGTGGATC
CGGTCACGTGCTCGCCATTTCCAACAAGCACGACAGGCCGTCATGGAGGGCCTCGTGGCACGGCTGATCTCGCTGCTGGC
GCACCACCCCGACTTTACGACGGAGCCGGACGAGCAGGTCGACCACGCGCGCTACGTGCTGTTCTACCTCAGCAACGTGG
CGACGGAGGCGAATCTGGGCCTGATCAACAAGTATGCCGAGCGGGTCAAGCAGACGCTGGACGGCATCGACGCTGGCTGC
AGCGAGAATTTGTACCTGCTGTCGGACCTGACGCAGGCGACGATTCGTCGGTTCCAGCAGCGCAAGGGCTGGGTGCTGGA
GCCGCACGCCGACAAGGTGGGCGTGCCGCAGGGGCTGTACGCGCCGCTGCCGTCGCACGAAGTGGCCCTGGAGATTGCAC
GGAAGCAGTACGTGCCGGAGGGAGTAGAGGACCAGATTGACGATCTGTTGAAGGCGACGGAGCGAAAGAAGGTGAGTGTG
GGTGTGTGGGTGATGACGAGAGGGGGCATGCTTAGTAATCACTAACGAAACAGAAGCGCAAATCTACCGACGAATACCAC
CTACTGCACGACGCCACGCAGCAGGCGGCCAAGCGAGCCAAGACGTCACGGCCGTCGCAGCCACGGGTAGAGAGGACGAC
GACGGGGTCGGGGCCCAAGAAGAGCAGCACGAGTAGCAGCAGGACGCCGAGGCCGAAGAAGACAGCCAAGCCGACGACAA
CGCCGACTCGGACGATTCCAGACTCGGAGCGGAGGCGTAGCGGCCGATCCGGACGGGCACAGCAGTCGTACATTGAGCGC
GACTCGGACGAAGACGACGACGAGATGCTGGACGGCGTGGCCGAGTGGGAGTATCTTAGGGGGAGCGACGACGAGGACGA
CAGTCGGCGAGGCACAGAAGGTCGGCAGAGACGAAACGGAGCGACGAGCGGCGTCTGGGGACAGTCGTTGCGGCAGGCAT
CCGACTCGGAGGGAGGAGAGGGTGAGGAAGAGGGGGGGAATGGAGAGGTGGAGGGTGGAGAGGAGGGTGGAGAGGAGAAG
GGTGGAGAGGAGGGTGGAGAGGAGGGTAGAGAGAAGGGCAGAGAGGTGGAGGGTGGAGAGGTGGAGGGTGCAGAAGAGGA
AAAGGAGAAGGAAGTAGAGGACAAGGAAGTCGAGACAGAGACGAGACCGCCTACAGACGGGCGGCGAGGTCGTGGTGGCA
ATCGATCGCTGCCGTCGCGGTCGCGGTCAAGACGGGGAAAAGAGGTCGAGGCGATGGACGAAGACTGAGCAGAGGTCACA
GCCCGGGAGAAGAAATGGATATGTATAGGGCGGTTGTTACGATGAATTGACACGAATTGTGGCGAGGACCAATGTACGTA
GTATGTGCAGTGCCTGCTTCACCGCCTTGGTGATGTTTTCTGCATTCTGCCGTTTTTCTGCCGCTGGCCAACGGCTTGAC
AACAACAGCCAGCCGTGTGAAGAAGCGATGGCGCCCAAACCGGCGCACCTGGCGCCGTCCGAGCTGGGGACGAAGGAGTA
GTAGGTACAGGCAGTGGCAGTGGATGGAGAGAGCCGAGTGGATGCTGACGGGTCTGCAGCTGGGATTCGCTCTATGCGAC
GGAGCTGGCCAACCACGCGGGCAACCCGGCGGACACGGGCACGGTGTGGTTTGACGACGTCGATGCCGAGACGCGCATGG
TATCGTATCTGGGAGATTTCCTGGAGGCAGACGCCGACGGCAGCAGCGACGGTTCCGCGTCGCGGCCGTCGCTGCGGGTC
ATTGATCTTGGCTGCGGCAACGGGTCTCTGCTGCGGGCTGTGCGCGACGAGCTGGCCGAGCGGACGATCGTGGCCGGCGA
GGTCTGTCTGCTGGGCGTGGACTACAGCGCAGCGAGCATCGTGCTGGCGCGGCAGGTGACGGCCGACACCAATGACACCG
ACGACACCGACGACACCGACGACACGATGCGACCGGCCATCGCTCTGGCCGAGTGGGACGTTCTGCGCGGCGACGCGGAC
GCGCTCGGTCTGCCGGCTGGTTCCTGGGATGTCGTCCTGGACAAGGGCACGTTCGATGCCGTCAGCCTCGGCCACGGACT
CGCCGACGCGGACACCACCTCCACCCAAGACACGGATACCGTCGAGTCGCTCTACCTCGGCCAGGTCCTTCGGCTGCTCC
GTCCCGGCGGCCGCTTCCTCGTCACCAGCTGCAACTGGACCGAGGCCGAGCTCGACGCCTGGATGACTGCCCCGGGCCCC
GACCCTACCGCCGGCCGTCTCGCTCGCGTCGGCCGCATCGCCTACCCGACCTTTCGCTTCGGCGGCGCCCAGGGCCAGGC
CGTCTGCACGTCCTGCTTCCAGAAGCGGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62