GenePrediction:GLEAN_1171 Details

Name: GLEAN_1171
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1074783..1078554 (+ strand)
Length: 3772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1074783..1074820 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:1074883..1077712 (+ strand)
Length: 2830
Type: CDS
Source: GLEAN
Position: GCSC_173:1077793..1078554 (+ strand)
Length: 762
>GLEAN_1171 class=GenePrediction position=GCSC_173:1074783..1078554 (+ strand)
ATGTATATCAAACAGCTCATCATCCAGGGCTTCAAAAGGTTACTATCACCTTCATCTGGCCACCGTGACCTGAATGTCTG
TCTCACACAGTTTCCCTTAGCTACAAGGACCAAACGGTCATGGAGCCTTTTTCTCCTGGCACGAACGTTATTGTTGGCCG
CAACGGCTCCGGCAAAAGCAATTTTTTCGCAGCCATTCGCTTCGTTCTTGGCGATGCCTACACACAGCTGAGTCGTGAGG
AGCGCCAGGCTCTTCTTCACGAGGGCTCTGGATCTGCCGTGCTGTCTGCCTACGTGGAAATCATCTTCGACAACAGCGAT
AACCGCTTTCAGACGAACAGCAAGGAGGTCTCGCTCCGGCGAACCATCAGTCTACGGAAAGACGAGTACGCCGTCGACAA
GAAGGTGTCAACCCGCAGCGAGGTGATGAGCATGCTGGATACCGCCGGGTTCTCCCTGAAGAACTCCTACTACATCGTTC
CCCAGGGTCGCGTGACCGCCCTGACCAACATGAAGGAGTCTGACCGGCTCAAGCTGCTGAAGGAGGTCGCTGGTACGGAG
AGCTACGAAGCACGGCGTGCCGAATCACTCAAGATCATGGGCGACACAGAGAACAAAAGAGCCAAAATCGACGAGCTGCT
TGAGTACATCAAGTCTCGCATGAGCGAACTGGAGGAGGAGAAGGAAGAGCTGCGTGGCTTTCAAGAAAAGGACCGGGAGC
GACGATGTCTGGAATACGCCTTTCACCACCACCACCAGGTTGCTCTGACAGAAGCTCTCGAGGAGATTGACCGCACGCGT
CAGGACGGTGCCGACAACTCTGGCACAAACCAAAAGCTGTTTCTCAGCGGCGAACAAGCTATTTCCAGGATTGAGGGCGA
GCTCCTAGAGCTACAGCGCTCGCTCGATCTTTTAAATATGGACCGGCAAGAGTACGAAAACGACGCCCGCGACATATCTC
GGAGTAAGGCCAAGGCAGAGCTGAAAGTAAAGAGTCTTGCCGACAGCCAGAATGTCGTCGAACTCTCCAAGCAGAAGCAC
GATGTCGAATTAAAGGCGGTGCGCTCAGAAATTGCGTCCAAAGAAGGCCAGCTGGCACATATTCTCCCTGGCCTCGAAAA
GCGGAAGGCCGCTGAAACCGAGGTTCGGCATACCTTGCAGACGACAGAAGCACGGCGACAGCGGCTTCTCAACAAGCAAT
CTCAGGGCGACCGATTCAGAAACAAGGCTGATCGTGATCGGTGGATCGACGGACAGCTGTCTGAGCTACACAACACCCTT
GGTGCCCTCCGGGCCAACCGTGTGTCGGCTGCCGAAGAGACTGAGGAAGCCAAGAGTTTCATTGTGTCTCTAGAGACAGA
TGTCGAGCACCTATGGAAAAGCATCGAAGGGTTTGGCTCCCGTCGTACGGCGCTCGCCGAGAGCCTGTCTAAGGCTCAGG
ACAAAGTGCAGAAGCTGGACGACGAAAGGCGGGCGCTCCGACGTGAAGATGACAAGCTGAACACCGAGATTTCGAACGCA
CGACAGGAGAGGGACAGAGCGAACCGCACTCTCAATAATTCTATGGATAATGCCACAGTACGCGGCCTAGCCACGATTGA
ACGTCTGAAGCGAGAGCAAGATATCCCGGGAGCCTACGGCATTCTAGCCGACCTGATGGAAGTCAGCGAGGCCTACAGAA
TCCCGGCGGAGGTGGTCGCTGGAAACAGCCTCTTCCACTACGTTGTCGACAACGAGGAAACGAGTACTCTGCTTTCCAAT
GCTCTGTACCAGCAGCATGGCGGACGGCTCACGTTCATTCCGCTGGAACAGCTACGCCCACGCGCAGCCAATTTCCCGAA
GGGTGTCAAGGATGCTCTGCCTCTTGTAGAAAAAATACAGTACAACGCCCGTTTCGAGAAGGCCTTCCAACATGTTTTTG
GCAGCACTGTCGTTTGCCCCAGCGTGTCCGTTGCCGCACAGTACGGCCGCAGTCACGGTGTCGATGGCATCACCCCCGAC
GGTGACACTACAAAACGCACTGGTACGATGACGGGTGGCTACGTCGATCCGTCGCGTTCTCGTCTCGAAGCTATCCGAGC
AGTCAATCAGTGGCGAGGCAGGTACGAAGACCTGGTGGCGCAGGCAGATCAGATCAAACACCTGATGGACAAGAAAGAGC
AGGAGGTGACAAACGCAAGAGGAGAGGAGCAGAAAGTTCTTCACCAAGTGAGGCAATTGGAGGAAGGGTTCGGACCAAGT
CGAACGGAGCTGAGTGCCAAGAGGGCGCAATTAGAGAGGGAGCGGGCGCGTCTGGACACGCTCAGCAACCGATACGACTC
GATCAACAAGAACATGGACGAATATGCCACGTCGGTCGAGTCGTTTGAGGCGGAAAAGAAGTCGGACTTCAAGAAGGCGC
TCACGGCGGCAGAGGGGATGCAACTGGAGTCGCTTAACGGCGAGGTGCAGACGCTCCAGCGGCAGCTTAACGAAGCCAGC
AGCCGGCGCAGAGAGATTGAGAGCCAAAAACAGATCCTGGAAGTGGACTTGCGGCAGAATCTGCGCATGAAGGAGGACCA
GCTTACCAGTCAGGTGTTTGATACGATGACATCTGTAGGTGGAGACGGCAACTATGTTGAGGCCCAGAAGGAGCTCAAGA
AACTGCAGAAGCGTCTCAAGGAGAAGGAGACGAAGCTCCGTGAGACGATGGACGACATTGACGGGAAAACAATACAAATC
AATGAGCTCCGGGTAAAGAAGGGCGAGCTGGAGCAGAGGCAGCAGGAGATAGCCGCAAACCTGGAGCGAAGCCAGAAGAG
GATGGAAAAGAACCTGCAACGACGAGCACTTCTGACACAGCAACTGGCAGAAGCGGCGAAGAACATCCGTGACCTCGGCG
TGCTTCCGGAGGAGGCGTTTGAGAAGTACGAGCGGATGGACCCAGCTAGAGTGAGTCTGTTTCTATACGTTATTTTCACA
AGACCGACAACGAGAAATATCTCGTGGCAGAGGCTAATACAGATGTGCAGATCTCCAAGCGCCTCAAGAACGTCTTAGAA
GCTCTCAAGAAGTACCGCCACGTCAACAAGAAGGCATTTGAGCAATACAACAGCTTCACGAACCAGCAGGAGCAGCTGCT
AGGACGACGAATGGAGCTCGACGAGTCACAGGCATCCATCGAAGAGCTTGTGGCTCATCTCGATCGTGTCAAGGACGAGT
CCATCGAACGGACGTTCAAGCAGATTTCCAAGGAGTTTGCCATGATATTCGAGCGGCTGGTTCCAGCAGGACACGGTCGG
TTAGTCATCCAGCGACGGGACGACCGGCGCGGCGGCCAGCAGGACGAGGAGGAAGACGGCGAGGGCGAAGGCGACAATGA
CAACCGGCGCACTCGTCGCAGTGTCGAGAGCTACACGGGTGTTGGCATCAGCGTGTCGTTCAACTCGAAGGACATGGACG
AGCAGCAGAAGGTGCAGCAGCTGAGCGGTGGCCAGAAGAGTCTTTGTGCGCTGTGTCTGGTGTTTGCCATCCAGCAGACG
GATCCTAGTCCCATGGTCGTGTTCGATGAGGTGGATGCGAACCTGGACGCACAATACCGAACGGCAGTGGCTGGCCTGCT
GTCGTCAATCTCCCAGGACGCGGGGACGCAGTTTATCTGCACGACATTCCGGCCGGAAATCGTGCAGGTGGCTGACAAGT
GCTACGGTGTGACATTTACGAACAAGACGAGCTCGATCGGCTGTGTGACGACAGAAGAAGCGCTCAGCTTCGTGGAGGGC
CAGAAACAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62