GenePrediction:GLEAN_1174 Details

Name: GLEAN_1174
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1104633..1107104 (+ strand)
Length: 2472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1104633..1104793 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_173:1105210..1106953 (+ strand)
Length: 1744
Type: CDS
Source: GLEAN
Position: GCSC_173:1107018..1107104 (+ strand)
Length: 87
>GLEAN_1174 class=GenePrediction position=GCSC_173:1104633..1107104 (+ strand)
ATGCTGGGCTGCCGTTGGACCGCTACCACGCCGCTAAACTATACTGGGACGAGCACAGGTGTTAGCGTCTTTCCCGCCCG
CCAACCAGTCCAGCAGCGTCTTCCGGCCACCAAGACCGCCAGACAAACGCCCTGTCGCGCCTGCTTCGTCGTCCTGTCTC
GGTCCCATCGCGACTGCCTGCAGACGGCGCACCCTCCTTCCCTTTTTTGCAGCTCGACGCATCCTGTGATTCCGCCCTCG
TCTTCTCCGCTTCTTCGCCGTCTTTCTCACTCATCTTCTCTCGTCTGCTATCACTACTCTCGTTGTCACTGTCACCAGCA
TCGCCCGGCCGCCGTCGTCGCCAAGCCCACAAAACTGTCTGCGCCGCTGCCATTGGCCACTGCCAGACGCGACTCTTTGA
CCCCTTCATTCGCCAGGCCAGAGCGGCAAAAGAGATTGCAATCGCCAGTCTCTGACCTCTTCCTCCTTCTTCTCGTCCTC
CTCTCTCTCGCCTCCGCCGCGCTTCCCGCCATTGACCGCCTGTCTCTACCCCGGATTCTCTGCCCGACCCCCCTATACCA
CCACCTCTCACGTCCAGAGGAGGCCGTTTCGGCGGCCGCCCTCTCGTCCTCGTTCCCACGGCTTCTCACGCACCGCCCGC
CAATCTTACAAATTCGACGGCCGCCATAGCCTCTTCCTTCTCGGATCCCTCTTCCCTTCCTGTCAATGTACCCTTACCTG
CTCCGACGACATTCCCCGACCCAGGCTCGACACCGAATCCGCCTCCTGCTGCCGCAGCTGCCTCTCGTTACGCTCCGCCT
TCGTCCTCGCGTCCTTTCGTACCTCTGAACTACGGCCAGCCGCCTTTCCGATCGCGTGCTGCAACGACTTTTCAGCGTCC
CCTCCGCCGGTTGTCTGCTGCCCGTCTCTGGAATCCGACCAACTCAACTCCGCGCAGCACCGCCTCATCGGCACGTCGCA
ACCATTCGCATCTGCAGCCGCTGCTACGACCACAGCCGCACGCTCCAGCCCACAGACGGGCGCCTTCCACGCCGCTGCCT
CCTGCTGTTGCTCTCTCGCATCCTGTTCTGCACGATACTCGCCCCGTTGCAGACGACGATCCCATTGGAACCGGTGTCGC
CGACTACCCTCTTCTCACCCTCCCCGAGCAGCGCCAGGTCCGCCACTCTACGTCGACCCGCGCCAGCCTGCAGGTCGAGC
GTGCCGGAAGCGAAAAACGGGTGAGCTTGCCCAAGTCTCTCCGCCATTCATACGACGGAAAGCGTCTGGCCGTGAACCCA
GAATCCTCGCTTGCTGAGACGACTGACCTCGATCCTGACCGTGGCGTCGAAGCTGCTGAGCGGATCATTGCTAGTGCTGC
CGCGCCGCGTTTTTCCGGCCAATTTTCCTTTACTTTTGCTGGGCCGTCTTCAACGCCGGACCCAGGCCCTCAAATCGCAG
GACTGCGGAGACTTGGCCAAAGCGCCAGCAAGCCGCAAGCCGCGGAACTGTCACACCATTCAGAGACAGGCCGCCACCCG
CGTCCCGACTCGGCTACGGCTCCAGCTTCAGGAGGACCCTTCGGGCTCGTTTTCGCGCCAATCAAGGCCACCAAGCAAGA
CAAGGGAAAGGGCAAAATGGCGCCCGCTGAGAGCGAAGATGTGGCCATCACCCGTCGCTCCTATTCCAGGGACCTGGAAC
GAGGCCCCGATGTCATGAGCGCCATTGACGGAGGCTCTGGCGCGAACAAGGAGGATCACGCGAACCGGAACTCGACTGTG
TCTATGCCTGATGGGATCGGTATCGGCTCGGCCATCTCGTCGTCCAACTCGTCCATCATGGGCGACCCGGAGGCCCAACC
AGACGCCGGCGAGGAATGGGGGCCGCAACACCCGTGCTTTCCACACCGGAATCCGCACGTCCCCATGGACTCGCCCGAGT
ACGTGACCACACGCATCATCCGCATCCGGCGCGACTGGCTGATAGCAGGCGATCTGGCGCCGACCTTTTCGAATCTGTAT
CCTGAGATCCTAGACCCAGCAGGAATGCCCGAGCATGAGTTCCGGCGTGTCGTCGACAAGCTGAATAAGGAGCTGTGCGG
CATATTTGAGCCGTGGACCATACACAACATCATCGACGGCGTCCTCGGCCTCCTGACTGGCTGGCTATGGGAAGACATGG
GCATGACGACCGCCAAGAGGCGGCTGGCCCAACTGGAACGTTGGGTTGAGCGGTGGAACGAGTCCATGGCAGCAGGGATG
AACGGCAGCAGAAGCGGCCTCGCTGAGGACGGCCCCATTCCGCCCAAAATCATCCCCTTGCGGGAGACGGGCTATATGAC
GGTAAGCTGACTTGAATCCTCTCTCTACGGCCTGCAAGCTAATGCCGCAGTAGCTCGATATCCAGATAGGCGACCCGGAA
ATTGCGCCGGCACCAGCCAGCACAGTCGCATCGCGGGCTGGTCAGCCGATGGAGGAAGCATCGGCGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62