GenePrediction:GLEAN_1178 Details

Name: GLEAN_1178
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1138530..1141447 (+ strand)
Length: 2918
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1138530..1139138 (+ strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_173:1139207..1140373 (+ strand)
Length: 1167
Type: CDS
Source: GLEAN
Position: GCSC_173:1140440..1141156 (+ strand)
Length: 717
Type: CDS
Source: GLEAN
Position: GCSC_173:1141216..1141326 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_173:1141385..1141447 (+ strand)
Length: 63
>GLEAN_1178 class=GenePrediction position=GCSC_173:1138530..1141447 (+ strand)
ATGGCCAATACGAGTGACTCCACCACGCCTGGCGGCTCCGGTCTGCGTCTGCCGTCTACGCCGCCGTCGCCGACCCTGTC
ACGACGCTATCTGGCCAGCCGGCGCGGCTCCTGGGTGGAAGATGCTCCGGATGAGCGCACATCGCTTCTGCAGGGCGTCC
GATCTCGGCCATATACGCATGGCAGTGCCCGGCGTCCCTTCATCGTCCAATCTCAGAGCTTTGGCGGCAGCATCAACTCG
CGTCACCACAGTCGGACTGGCTCGTGGGGCCAGCGTCTCGCACACGCGCTCACAGACCGGCAGGACTCGTCCATGGTCGA
GTCCAAGGCGTCGCTCGCGTCTGACGAGCGCGTGTGGTACGACCAGTTCACGTCGACCGACTGGGTCCACGACAGTATCG
CCGACGCGCACCGTGTCAAGGCGCTGCGCAGCCGCAAGGATTTCTGGGGACGCGTCTACGTCCTGTTCGACGGCGTGCAG
GGCTGGCTGCTCTCGGCCCTGGTCGGCTTTCTCGTGGCCGTCATGGCCTACACCATTGACGTGACCGAGGCCGTCATCTT
TGACTACAAGTACGGATACTGCACTTCCGCGTGGTATTACACTGAAAAGGTGCGTCATTGATGCCTGTTGTGCGAGCGTC
TGTGCGTATGCTGATATGCTGACTGCTTTGGCTGCAGCAATGCTGTCCCCATGGCGCATGCACAAATTGGCGTGAATGGG
GCGAGGTCATGCGCAGCAGCGGCGTCGTCGAGAAATGGGCCGAGTACGGCGCGTACATCTGCGGCGCCATCATCCTGGCC
TCGGCCTCGTGCTTGCTAACCCTCACCACCAAGACGGTTGTGTCACCTTCGTACCGGCTGTCCACGCTGGACGAGAACCT
GGCTGCCGAGCCTGTTCCCATGACCGAGGACGACCATAGTGCAGATGGCGAGGCCACTGTCGTGATTGGCAGCTCTGGCG
GCATCGACGACGCTCCGGCTCCGGTCAACAAGCCTGCCCGGGCTCCCCCCACGGTGTACTACACGGCTGCTGGCAGCGGT
GTGGCCGAGGTGCGGGTCATTCTCAGCGGCTTCGTGCTCCATGGCTTCCTCGGCTTCCAGACACTTGTGGTCAAGTCTCT
CGGCCTCGTGCTCAGTGTGGCCTCAGGCCTCAGTCTGGGCAAGGAGGGACCCTATGTGCATATTGCCACCTGTGTCGGCA
ACATTGCCTGTCGACTCTTCTCCAAGTACGACCAGAACGACGCCAAGCGCCGGGAGATCCTGTCGGCAGCGGCTGCCTCG
GGCGTGGCCGTAGCGTTTGGCGCTCCGCTGGGCGGCGTCCTGTTCTGTCTCGAGGAGGTGGCCTACTTCTTTCCGGCCAA
GACGCTCTTCCGCACCTTCTTCTGCTGCATCACGGCGGCCCTGACGCTCAAGTTCCTAAACCCCTACGGCACGCACAAGA
TTGTCATCTTCCAGGTCGACTACGACATGGACTGGGAGTACTTTGAGCTGGTCAGCTTTGTGGCTGTCGGCATTCTGGGC
GGCGTCACCGGCGCGGTCTTCATCAAGGCGTCACGCCTGTGGGCCAAGCTATTCCGCGGCATCCCGCTCATCAAGACCCA
TCCGCTGCTCGAGGTCGTTTTGGTGGCGCTGGTGACGGGCATCGTCAGCTACTGGAACGTGCTGACGAAGCTGTCCGTGA
CGAAGCTGCTCTACAACCTCGCAGCGCCGTGCGACGTCACCGACAACAACCTGGACGACCTCAGCATCTGCCCGTCGGAG
AAGGACGACATCCCGCCCATCTTGATGAAGCTCTTTGGGGCCTTTTTGATTAAGGGAATCCTGACGATCATCACGTTTGG
AATTGTACGTCATGCGTCTTGCGTCCTGTGATTGTCGGTCACCTGTGCTTGATTTGCTAACAGCCGGTAGAAAGTCCCCG
CCGGCATTTACGTGCCGTCCATGGTTGTGGGAGGCCTCATGGGCCGCCTGGTCGGTCACGTGGTTCAATGGGTTGTGCTG
CAGACGCCAACATGGGCGGTCTGGAGCAGCTGTGCGGCTGCAGGCGGGACGGGCTGCATCCAGCCGGGCGTGTACGGACT
GGTCGCGGCCGGGGCGACCATGTGTGGCGTCACCCGGCTATCGGTGACGCTGGCTGTCATCCTATTTGAGATTACGGGTA
GCCTGGATTACGTCCTGCCGTTCTCGCTGGCCATTCTGGTAGCCAAGTGGACGGCCGACGCGATCGAGCCGCTGTCGATC
TACGATCTGCTGACCGAGATGAACTCGTACCCCTTCCTCAACAACAAGCACAAGCCCATCTTTACGTCGGACCTGGCCGA
CATTGTGCCGCGTGTGCGCCGCGAGCGTATTATTGATATCTCGTCGTCGCCGCTGGTGCGGGCCACCGTGCTCCGTCAGA
AGCTCGAGATTGTGCACCGGGCCGGCGAGATGGACGGTGGACTGCCCATTGTGCGACACGGCATTCTCGTCGGCCTGATT
CCCGCACCCGACCTGGAGTTTGCCCTGGACAACCTGCGGGACGAGGCGACTAGCCTGTGCTTGATGGCTCATGTGCCGAG
CATCGACGACTCGGACGATGGAGAGACGGTTGTGGATCCGACCGACTTCACGCCCTACATCGACCGGGTAAGAAGGACAT
CTGCTTTTCGCTTTACACTGCTCGCAGGCTAACCGATGTTTACTAGGCCCCTGTTGCGTTGGACATCAGGTCACCCATGG
ACCTGGTCTACCAGTGCTTTGCCAAGCTGGGGCTCCGGTACATCTGCGTCCTCCGAGACGGCCAATATGCCGGCATGGTA
AGTGTCCTGCCTGCCCAACTGCTAGTCTTTATTTGTACATGCTGACATGAACAAGGCCCATAAGAAGACGTTTGTGCGAT
ATGTCCGTGATCTGGAAAATCACGAGGGGCACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62