GenePrediction:GLEAN_1179 Details

Name: GLEAN_1179
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1142263..1145505 (+ strand)
Length: 3243
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1142263..1143046 (+ strand)
Length: 784
Type: CDS
Source: GLEAN
Position: GCSC_173:1143959..1145505 (+ strand)
Length: 1547
>GLEAN_1179 class=GenePrediction position=GCSC_173:1142263..1145505 (+ strand)
ATGACGGCTAGCCGTGGCTTGATGCTGTACGCCTCGGCCGCCGTGGTCGGGCTGCTGGGCCTCGGCCATCCTGGGCCGGC
AAAGGCATCGGATCCGGCCGTGATGCAGCCGTCGGTGGTGCTGGAGGCGGCAGCGGTGACGGCGACAGCGACGATGACGA
TGATGAAGCCGGCATCGGCATATTGGTCGGCAGCCGCCACCGGCAGTCCGTCCCCGGCTGCCATGGGGGGTCCGGAGACG
TGCCAGTTCAAGACGATCAACTACATCACCCACACGCTGCCGCAGCAGTGTCTCCGGACGGCGTGGTCGAGTGCCAATGC
CACGTCAGCAGCGGCCATGAGCGACCGTGCCGTTCCGACGGTCGTGGTGACGACATCCGTCCCGGCCACAGAGACCACGA
CGTCAGCCGCGACCGCAACGATAGCAACAGCACAGCAGGAAGCAAAGGAGAGCACGACAGCAGGCGAGAGCGGAGTGAAG
ACAAGAATGGGCGGCCACAACGACGACGACGACGACGATGACGACGGGCAAGACCTGGCGACCGGAACGTTCATGTCGTT
TGAGCAGTGGAGGGTGCTGCAGCTGCAAAAGGCAGGCCAAGACCCGGCCGATCTGCAGGCACGGCGGCGGCAGCACGGCC
GAGGAGGGTCGGGCGGCGGTGGTGGCAGCAGCCATGCGGACATTGACAGCATCGGGGACGACGGAGAGATCTCGCTAGAC
TTTGACGTGCTCAACGAGAAGGTGACGGAGATGGCAGACTCTGCGGCGGCCGAGGCGCCCGGACGTGAACGACAGCACCA
GGCGGACGGCCATGGGATGACGTCTGGGTCGGGCAGCAGCAGCAGCAGCAGCAGCAGTGGTAGCAGCGACGGATCGCGGC
TATCGGCAGACGAGGCGGCAGCAGCGGCGGCGGCACACAACTACCGCAGCAAGGATGCCGGCAAGACAGGCAAAGAGCGG
TTCTCGTTCGCGTCGTTTGACGCCGGAGCGACGGTGCTGAAGACGAGCAAGGGGGCCAAGAATGCCAAGTCGATCCTGGT
GGAGAACAAGGACTCGTACATGCTGCTGGAGTGCAATGCGGCGGACAAGAGCGTGATCGTGGAGCTGAGCGACGACATCC
TCGTCGACACGGTCGTGCTGGCCAACTTTGAGTTTTTCAGCAGCATGGTGCGGCGGTTCCGCGTCAGCGTCAGCGACCGC
TACCCAGCCAAGGCCGACCGCTGGCGCACGCTGGGCGAGTACGAGGCCCGCAACCTGCGCGGCATCCAGCCGTTCCTGAT
CGAGAACCCGCAGATCTGGGCCCGCTACATCCGCATCGACTTCCTCTCTCACTACGGCAACGAGTACTACTGCCCCATCT
CGCTGCTGCGCGTGCACGGCACCCGCATGTTGGACTCGTGGAAGGAGATTGAGAACGGGCACGACGAGGACGAGGACGAG
GACGACTTCGCCAAGGACAGTCCCAAGGAGCAGAGGGGGCACAGAGAGCAACCAGCAGAGCAGCAGGAACAGCAGCACAA
GCAACACGAGAAACAGCAGGAGAAGCAGCAACACAGGCAACACGAGCAACAAAAGTCATGTGACTTTGCTGTCAGCAACA
AGCCCAACGGGACCGGCTGCACGTCCTGGCGTCCCATCGCCTTGCACGAGCAGCTGTTCGCCTTCCCGACGTGTCCCAAG
CCGTCTCCCCCCGGAGCCAACAACGGGTCGCTCTCGCAGGCCGAGACGGCAGCAGCAGCCGTTTCCGGCGGCAAGACAGC
CTCAGCCTCCACCACGGCTGCCGGCGCCGCGGCCGAGAATCCGTCCTCGTCCTACCACTCGCCATCTTCCGCCCACACAC
CCACACACACCGAGGCACAGCTGGCGCGAGCGCCCCGATCGACACTGTCCGACGACAGCGGCACCAACGAGTCTCTGGCG
TGGGCAGCCTCCATCCCGAACCCAAACCAGCACGTGTCCTGGTCCATATCGTCGCAGCTGTCGACACCTGGCGACACACC
CATCTCGGCAGGCGCGTCCACCAATCAGCCGTCGGTGTTGAGTGGGTCGGTCACGACAGCCGTTACCACCGGCATCCATG
CCGATGCTAAGCCCAACTTTGGATCTGGCTCTGGGGCAGGCGCACCGCTGCCTGGAGGCTCGCCGACGGTGCAGGAGAGC
TTCTTCAAGTCAGTCACGAAGCGGCTGCAGCTGCTCGAGTCCAACACATCGTTGTCACTGCAGTACATTGAGGACCAGTC
GCGCTTCCTGCAAGAGACGCTGCGCAAGATGGAGCGCAAGCAGATCACGCGGGTGGACGGCTTCCTCTACACGCTCAACC
GGACCGTCCTCTCGGAGCTGAGCCAGATGCGTCAGCAGTACGACCAGATCTGGCAGTCGACCGTGCTGGCCCTCGAGACC
CAGCGCGAACAGAACCAACGCGAGACCGTGGCGCTGAGCGACCGCCTCAACGTGCTGGCCGACGAGGTCGTCTTCCAGAA
GCGCATGGCCATCCTGCAGTCCGTCCTGCTGCTCTGCTGTCTGGCCCTGGTCATCTTCTCGCGCGGCCTGGCCGCCGTCG
CCGGCATTCCGGCCATCGCCGGCAGCAACCCGCTCTTCGACCAGAACCTCTTTCCTGCTCGCACCACCTCTTCTTCCGGC
GTTCGTCCGCCACCGCAGCCCGAGTCCGCACCGACGTCACCACCCTACTCCGTCGGCCTGCGCCGGAACCTGCGCTATTT
CCGCGACAGCCTGCGCAGCCCCGGCCTCTACTCCGCCTACAGCTCCGCCTATCTCTCCGGTGCCAACTCCCCCGCCTCTT
CCCCGCCGCCTCCACCGCCCGGAGCCGCTCGCACTGTTGGTCCCGTCACCGCGTCCAGACTGCCTGCAAACACCGACAAG
ATCCTGCCGCTCACCCCGACCACCCCTACTTCGCCCGTCTCCATGACCATGCCCTCCCCTGAGCCTGAGCCCGACTGCCA
CCCGCCAGACAACCTCCCGGCTGCTTCTGCCGTCTCACTCCTTGACCTCGCCGCGGAGACTGCCACAACACACACGCAAA
TCTACGACGGCCAGCAAGGCAGCCGCTCGGTCGCTACCCCGACTCGACCCGGCAGCAACACCGGCCGACTAGACACAGAA
GCTGGTCTTCTCACACCTCCACGAATGACCTCGCAGAACGACGACTCTGTCCGGGTAGGCAGCGCTGAAACAGACAGCCA
GACTGCTGGGCGAAGGCTATCGCCGTCTTTGCTAGAAAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62