GenePrediction:GLEAN_1180 Details

Name: GLEAN_1180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1150753..1153354 (+ strand)
Length: 2602
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1150753..1150803 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_173:1150884..1152377 (+ strand)
Length: 1494
Type: CDS
Source: GLEAN
Position: GCSC_173:1152431..1152723 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_173:1152789..1153199 (+ strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_173:1153267..1153354 (+ strand)
Length: 88
>GLEAN_1180 class=GenePrediction position=GCSC_173:1150753..1153354 (+ strand)
ATGCCGCGCCGGCCACCGGTATACGACGACTACGGCACTGCCGTGCGTGAGGTACTGCTGACGAGGACACCGCTGAACGG
ATGAGCCCCCGTCTTCCCGCGTAACCTAGGCTAATGTGACTCTTCGGGCAGATTATTCTGGCTACGTCAGACTCCGACTT
TGTCGACCAACTGATTCCCGTTCTTAAAGATGCGACTGTCAACAACCGGACAGCAGGTCTGAACCAGAGCCTTGCACAAT
ACGTGGACGACAGAGAATCCGAAATCGAGAACATCGGGCTCACCAAACATGAAGAATTCCTCGGATCCGTGAACCAGCTG
CAGAAAGTGCGGGAGGGCACGGTGGCTCTGACGGCCGAGATCCTGGAGCTAAACCAGTCCATCCAGGCGAGCACGGAGAA
GCTGGCCAAGCAGAAACAGAACTTAGTCGACACGCGGGGGGTGCGACAGAATATTGCCGATGTGTCGGACGCCCTAAACG
AATCACTCAAGATCCTGCACGCTGTGAACAATGCACACGAGCTGGTTCGCAAGAAGAAATACTATGGGGCGCTCAAGTCG
TTGGAGGACCTGCAGAACGAGCACCTGGTGCCGATCATCCAGAACAAGTATGCCACGCAACATCAGCTGGCAGACCTGAT
CCAGAAGTCGATCCCGGCATCGCAAAAGACCATCTCAGAGGCCGTCATGAACGACCTGAACACCTGGCTGTTCCGTGTCC
GTGAGACGTCGCAGTTCCTGGGCGAGGTTGCCTTTTACCACACCGATACCCGGAGAACCCGCATGAGGGAGCGCGTGGAG
CAGAACGAGTTCCTGAAGCACTTCAGGCTCAACTCGGCAATCGAGCTGGTCTTTGACGAGAGCGAGGAGTTTGATGTGCT
GGATAACGAGGAGGTACGGGTGGACTTTACGCCCTTGTTCGAGGCTCTTCACATCCATGAGGCCCTTGGCAAGAGCGACC
GGTTCCGTGCCGACTACGCAGCCACTCGGCGCCAGCAGAAGGATCTCCTGATGCCGTCATCGGTGAACCTGGAAAACGAC
GACGCCGACTCCTCGCTGAGCAGCCTGCTCGAGGGCATTTCGGGCTTTGCCATCATCGAAAAGGCAACTATGCGGCGCCT
TCCGCAGCTGCGGTCGTCTGTCGATGTGGACGAGCTGTGGGATTCCATGTGCCAGACGGCCATCAGCCTGATCGCGAAGG
CTCTCAAGGACGTGGGCAATGCCGAGGTGCTCCTCAAGGTCAAGGGCATGATTGCCCTGTTCATACAGACCATGGAAGGC
TGGGATTACTCCATCACCATGCTGGACAACTTCTTGCTGAAGCTGTTTGACAAGTATGCCGAGCTGCTGAAGCGGCGTTT
TAGCGAGGACTTCCAGGAGATCGTGTCCACGGATGATTACATGCCCATGACGATCAACTCCTTGGAGGAGTATGAGAAGG
TCGTCAATGTCAGCTGGTTTACGCAGGACAAGCCCTTGTCGGAGTTGACGTTTCCCTGCGTCTTGCCCTTCTCGCAGATG
TATCCTCTATGCTGCATCGACATTCGGAATTTCCTCAACCAATTCTACTTTTTCTCTGATGACCACTTTCAGCATGCGAG
TATTATCGACGACACGCTTCGCAAGGTTAGAGCCACTCGCCCCCTCCAATTATGTCAGCTGTTCGCTAACCTTCACAGTC
ACTGGATGTACTCTTAAATGAGAAAATCTGCCAGTCTCTTGTAGAGCGTCTGAGCTCGCAATACCTGGGCCAGATCGTGC
AAATTCTCATCAATTTGGAGCACTTCGAGACGGCTTGCCAGGAGCTCGAGCAGTTGCTGATTCGAGCACGGTCATCCACT
TCAGCCGGCGGGCCTGCCACCTTAACAGCGACAGAGCAGTTCCGCAGCAATAAGAAGACGGCCGAGAAACGTATCTTTGA
GTTGGTGAACTCCAAGATTGACGATCTCGTGGATACAGCCGAGTACGACTGGTATGTGCTGCAGACCTCCCTCACTCGAT
GACTAAATGTATCTGTATGACTAATACAAAATGCAGGATGGCCCATACGGCGCAGACAGAGCCCAGCGGTTATATCCAGA
CCCTGACGCGCTACCTCTCGAACATCATGAACTCAACGCTGCTCAGCCTGCCACGGGAAATCAAGGAGTTGATTTATTTC
GATGCCCTCAGCCATGCCGCGGACAAGATCTTGAACCTCCCACTCTCACCCGACGTCAAACACATCAACCCCAACGGTGT
AGCTGCTATGGCGAACGATGTCCAGTCCCTGACAGAATTTGTCGGCAGCCTGGAGAATGCTTTTATGCTGGAACAAAACC
TAGACGAGCTGCAGCAGACGGTAGCCCTGATGCAGACCGACAACACAGACGAGTTTTACGATATCACAACACGAAACCGG
AAGTACGGGAGAGTCAATGCCCAAAATGGGGCGATCTTACTAGAAAAGTGCGTCGCCATTGTACATATGCTTTTGTCCTA
CTTCCATATTTGTCCCTGCTAACCAACCAAACAGGCTGACACACACGGTAGAAGGCCCGAATCGGGCAGCCCAGGCAGCC
CAGGGACTGGCAAACTTCTCGTCCCGATTCGGTCGGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62