GenePrediction:GLEAN_1181 Details

Name: GLEAN_1181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1156766..1157615 (+ strand)
Length: 850
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1156766..1157008 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_173:1157241..1157615 (+ strand)
Length: 375
>GLEAN_1181 class=GenePrediction position=GCSC_173:1156766..1157615 (+ strand)
ATGGCTACTGAAGTGTCCAATCTGAGCGAGGAGCAGATTGACACGCTCCTCCGAGAGGCGGAAGAGCGGTTGGCTTCTAA
ATCTGCCGGTTCAACTCGACGGCCAGGCCAGAAGATCACTGCGCAACTGCTGGCGAAAACGCCCGCGGGCAGCATCACTC
CCGAGGCCACCAAAGACGTCAAGCCAACCAAGACTGACGACGTGGCCGTTCGTGTGCCTGAGCCCAAGAAGAAGAAAGAG
AAGGTACATACAACTCCCTACCCCCTACCTGTGCCCTATTGCCCTAGAACTACAAGTGATGAAAATTATCCCATTTTTTT
ATTGAGGCAGCGAGATAACCCGTCATGGGAGATTCACCTGCACAAGCATGATTTCATAATATCATAGTTACTCTGATTGT
TGTTCCTGGCTGGCACATTCTTCCTGTCTTGATGTTGATTCAGAGTGGCATCGAAACTGACAGTTCAAACCATAGGATGC
CGCGGACGACGCCGGTCCAGACTGGTTTGGTCTTCCCAAAACTATACTCACTCCGGAAACCAAGAGAGACTTTCAGGTTC
TCCGTATGCGTGGTGTCATAGATACGAAGCACCATTTCCGTAAAGACACGCGCAGAGATATGTTCCCAAAATTCTCTGCC
TTTGGTACCATTGTCGAGGGCTCCATGGAAGGCAAGGGAGCTCGTCTGACACGGAAAGAAAGGAAGCAAACCATCAGTCA
AGAAGTGTTGGCTTCACATACGTCCAAGGACAGCTTCAGGAAACGGTACGACAAGATCCAGGAGCGGAAACAAAGTGGCA
AGAAAGCTTTCTACAAGAAGCTGGTCGGTCAGCGTCGGCGCCGCCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62