GenePrediction:GLEAN_1182 Details

Name: GLEAN_1182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1158333..1162490 (+ strand)
Length: 4158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1158333..1158498 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_173:1158644..1159003 (+ strand)
Length: 360
Type: CDS
Source: GLEAN
Position: GCSC_173:1159114..1159222 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_173:1159825..1159860 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_173:1159938..1160362 (+ strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_173:1160440..1160621 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_173:1161211..1161636 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_173:1161693..1161894 (+ strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_173:1161994..1162490 (+ strand)
Length: 497
>GLEAN_1182 class=GenePrediction position=GCSC_173:1158333..1162490 (+ strand)
ATGCTGGACGAACGACAAGGCTTTCTTCGCGTTACGGCCTACCACCGCGACGACTACGACCTAGCCGTAATCCGGACCGC
GCCCCACGAACAGGGCGCCTTCTTATCGCTGCTTTCCCAGCCTTTTCAGCTACCGGGCACCGCTCTTAGCTCGCTGGCCT
GTCTCGGTGTCCTACCTGTGGAGATCTTGCCAGTCTATGCCTCTACTTGAATCTAGGAACATCGTTCCGGTTTCGCCAGG
TCAATCGGACAGTCCACGGTGTTGTGGCGGGTCTGCCTGCGTTTCGCGGCATTACAACCCATGCCCTGCAGGCCCTGTTG
GCATGCTGCGCACCGGTATCGCGGCCTGTATCGCCTTATACAAGCTATACGGGGCGCTCTGCGCTTATGAATGTGTCCGG
TGCGGTGCGTTCGGCAGCCACCTGGATTTATCTACCTCACAGCGCTACTGCTTCGCGTGCGTGCAGTCATGCCCCTGCCT
ATGTGTTACGCTGCTCTCGTGCTTCGCCAAGGCTGCTATACTGTCGCCGGCCCGTCTTCGCCGCCTACTACTCCTACTGA
ATGTTATCCGCAACACGTTTGGACTGGGAAATCGCGTGCTTCATTACATGGCTACGGTAGCATCTTATGTGCTGGATCGG
ATCACTGGCGTCGTGGAAGCCGGTGTCAGCTGTAAGAGCTGCCAGGTGGTCAGGAACAGACAGGTGCACACTTGGCTTGG
CGCCACGACCACACTTATTCGGTCAATGAGTTTCTTGTTAATTTTAAACCATGACCAGAAGCACAAAATTTACGGGCGGC
AAGCGGTGCTGTTGCGGTTCGCGTGCACGAGTCCGAGTTCAAAAAGAGGCGTGGCTACCTGACAAAACTTGACAGCAATG
GGAGGCCCAGGTAAGAGGACAACATAGTTGCGTGGTTTTGCCTTGGAATGGCTGTGCGTATGAAAAGTAAATTGATTTGA
AATTTTCCGAAACCAATAATTCATGAAAGTCCAAACTGTCACTACCGCAAAACGTCGCTACCACTAGCAACTTAACGTTG
GTATCCTACTCCGTACTCCGTACATCTACGGAGTAATAGCTAGACTTTTTACGTTATAACACTGTGGTAATGCACTGTGG
GTAACTTTCCGATAACGGCAGGTTCTTATCGGTGAACGCGCCAAAAATCTTCAAATCTGTGCTGGATGTGCATTGAAGTG
AACAGCGTGCCTTCCAAGTCGACAAAGATGAATGCTCCTTCATTAATACGGTCCCTCCGCTTGGCGGCCAATGTATGTTA
TAAGTGAGATCCCGATATATCCGGAAGGAGTTGGTCACGAGGGCGGTTGCTGACGAGAGGCTCTACAGCCGACGAGATGT
GTGTGGCAGCAAGCAATGCTACCTGCATCCAGCCGGTCGAATAGCTCCTTGTAAGACTTGTCCGGCTCGTATGCAATGCT
AGCGAAAGGAATATTCAAGGGCTCGAAATTGATGAGACCTTATTGTTTATAGAGCCTCCACGGGCTTGCAGCAGGTACAG
AAGGTCGGGTAAGTCAGCCCACATCCGGATCTTTGCGCCATTCCCAAGAGAGAAGCCCACCGGCTGACTTCGTCCGTCTC
TCTAGTATCTATGCCACCGATAACGCCAGCGCCGAACCCCGCATGCCGCGTGCTGTCCAGGCGCTCTACCTCCGGCCGCT
CCGCCGCGAATGCGAGTACGGTGTTCCCTCGGCCGACCTGCAGCTGCGATCGTACAGCAAGCGCAGCCTAGAGTTCTTCT
CAGACTTTGCTATGCGGGCTGCATACTACCTCGGTCTGCCAGCGTTTGGGCCTGTACCGTTGCCGCGGATCACAGAGCGG
TGGACGGTCCCCAAGTCGCACTTCATCTTCAAGAAGTCACAGGAGAATTTCGAGCGTATCACGGTGCGCCGGCTGATTCA
AATCCGCGACGGCCACCCGGAGACAGTGCAGCTGTGGCTGGCCTTTCTCCAGAAGAACGCCTACTCTGGTGTGGGGATGA
AGGCCAATGTGTGGGAGTACAGCAAGCTAGGTAAACTATTTCCAGTCCTCTTGGGACGTATCTCCGTACGCCGTCTCGGC
CACCAGAAGCTGACAGTGATGGCACAGACGTGGGCAAGCAGATGGACAAGCTGGCGGAGGATATGGAAGGCCTGATGGAG
TCGCGGTGGGATCAATTGGGTGAGAGCAGGATCACAGCCAAGATGGAGGAGGTCCTGGCCAGTGCGGGGGAGCCCGATGC
AGCAACAGTCCAGCAGCTCAAGGAGCTCCTGGCTTCGGAGCGCGTAAAGGTCACTGGTGGCCGGTGATCAGAAACGAGCT
TCAAAGAAGTCAAAGAAGGACGACATTGACTGGATATTTAGGTGTATATTAACGAGAATCCTGTTCGATACATACGTATA
TGACTGCAAGCAACTTCTTTGCTATTTTAGCTTGTGCAATGTAGTGAAGACGGAAGCTGCCAATATTGCACACCATAAAT
GTTGTGTTTGTTGTCATCATCAATAGGGGTCTATGTGTTTCGCCGGGCTGCTTGGCTATTGTAGGAGAGAGCGTCGCTCA
TTTGATGGTATTGCCATGCGGCTCAATTCGGCAATCGCAACCTAGCAAAAAAGTCGAAATTGTTCACCAAAATTAGAGTA
GATGGCATCAGGCAATTTCACTCATGCCAATTCTTCTCCCAGCTGCCATTTATACCAATCTTGTTCAATCCGTTTTCCTC
ATGTCATCATAACACACTTCTGTCCAACCGTCTCCTATTCGCCATTTACCTCCACAGATGCGATGTGGTACAATCGCTCT
CTGCTAGGAGCTGTTCCAGCCGGCCGTCTTAGATTGCCGCCTACACGACCACCATTACTGCTTCCTTGGACATGTCAGCG
CTGCTTTTCCGAGGAGAACAGAAGACTAGAACAGTCACGGCCCCCTCCTGAGGCACCGATTCAGGGCGGAGCCGTAATCT
TCTCCGGCATCCAGCCGACCGGTGTGCCACATCTCGGCAATTATCTCGGCGCTCTACAGCAATGGGTGCGGCTGCAGGAT
GCTGCTGGCGTCGGCGACAATGCTACCAAGCTTTACTACTCTGTGGTAGACCTACACGCGCTTACGACGACCGCAAGTAC
CGGGGGCGGCGACGCCCTTCGCCAACGTCGTCGCGAGATGCTGGCGGCCTTGTTGGCGATCGGTCTCGACCCGGAACGAT
GCGTACTGTTTTATCAGTCCTCCGTGGCGGCCCATTCGGAACTCATGTGGCTTCTTAGCTGCACGGCGTCTGTCGGATAC
CTCTCACGGATGACCCAGTGGAAGGTGAGCTCTCATACCATTTCCTCCCGTCTTAGGTTGCTTCTAACCCGCCGTTACAG
AGCAAGCTCCAACTAAAGGACAACGTGTCGTTCGCCGATGAAAAAGCCCGTGCCGGACTCAAGCTCGGACTCTTCTCCTA
CCCAGTCCTACAGGCTGCCGATGTGCTCGTCCACCGCGCCACACATGTTCCTGTCGGCGAGGACCAGGCCCAGCATCTCG
AGTTTGCTCGCGAGTGTGCCACCAACTTCAACCACACCCATGGTCCTCTTCTCGTGGCACCGACCACCCTTCTATGTAAC
AATGCCACCGGTTTTTCTCCTGCTTGTGTCGTCTTTCTGCATCTTCGCTGACCGTGTCCAGCCCCTGCACGTCGTGTCAT
GTCGCTCCAGCAGCCGACCTTCAAGATGTCCAAGTCGCACGCAGATCCCCGCTCCCGAATTCTTCTGACTGATACGGCCG
AGACCATAAAGGCCAAGATCATGGCCGCCCTGACCGACTCGACAAACGCCGTATCCTATGATCCGGCCGGCCGGCCGGGT
GTCGCCAATCTCCTGGAGCTTCTGGCGCTGGTGGGAGTGGGAGAGGGCGACGGGGCATCCGCTGATTCTCAACAGGAAGT
CTCGGCCCTGGCTGCAGCCATCGCATCCGAGCTCGATGGTAAACCGCTGCGGGTCCTTAAAGAACGTACAGCTAATGCCG
TGGTGCGCCGTCTCGCTGGTATTCGGGAACGCTTTGTTGATGCCCTCGAGCGGGACGCGGGGGCCTATTTGGACCGCGTG
GCGGCCCATGGTGCTAAGAAAGCCCAGGCAAATGCGCAAGAGACCATGGAAGCTGTGCGGGCGGCTGTTGGTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62