GenePrediction:GLEAN_1183 Details

Name: GLEAN_1183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1167544..1169874 (+ strand)
Length: 2331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1167544..1167898 (+ strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_173:1167959..1169054 (+ strand)
Length: 1096
Type: CDS
Source: GLEAN
Position: GCSC_173:1169115..1169376 (+ strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_173:1169449..1169874 (+ strand)
Length: 426
>GLEAN_1183 class=GenePrediction position=GCSC_173:1167544..1169874 (+ strand)
ATGTTCATCCCGTCCTCCTCTGGCCCAGGACTATTGCCGCGCTTCTTTGCCGCCTCTCGCGCCCAACCTGCAGCAGCTGC
TCGACTCTTTCTGGCCGGTTCTCAGAGCCAGGCCCTCTCCACGTGTGCTGTCCAGTCGCCACTGTCACGCGCTGCATACT
TATCAGGCCGCCCGCGAGTCTTTGCTGCTGGTCTGACTGCGGCTTCCAATCGTCGGATTGTCAGACACCACCGCCGGAGC
TACAACCAAGCCCACGGTGACACCGCGGCAAACGACATGATTGAGACGATCGACACGAGCGCACGCCTCGAGGCGTTGCG
GACCTTGATGAACGAGCACCACATTGATATATACAGTTCGCAGATTCCTGACCCATCTGTCCTGTATGTAGTGTTCTGAC
ACCGCCTTTTTGCAGTCGTCCCGTCGGAAGATGCCCACTCATCCGAGTACATTGCGCCTTGCGACGGTCGGCGGCAGTTT
ATCAGCGGCTTCAGCGGTTCGGCAGGCTGTGCCATCGTCACGCTCAGCAAGGCTGCGCTGGCCACAGACGGTCGCTACTT
CAACCAGGCCTCCAAGCAGCTCGACAGCAACTGGCTGCTCCTGAAGCAAGGCATCCTGGAAGTGCCCACATGGCAGGAAT
GGACTGTGACTGAGGCTGCGGGTGGAAAGGTCGTGGGAGTTGACCCGACGCTGATATCGAACGCAGCGGCCAAGAAGCTC
GCCGACAAGATCAAGAAGAGCGGCGGCGGCGGCCTCAAAGCCATCTCTGCCAACCTCGTTGATGCCATCTGGGGCGTCGA
CCAGCCGCCACGGCCGGCCGAGCCGATCGTGCAGCTGGCGGGGAGCTATGCTGGCAGAAGCATCAGCGCCAAGCTGGCAG
ATTTGCGGAAAGAGTTTGCAAAGACCAGCGCTGCCGGATTTGTGGTGTCCATGCTCGACGAAGTGGCCTGGCTGTTCAAC
CTGCGTGGCAACGATATTCCCTACAACCCGGTCTTTTTCTCATATGCCATCGTGACGGCTGATAATGCGCTGCTGTATGT
CGACGAGTCCAAGCTCACGGCCGAGAGCCGAAGCTATCTCGCCGAAAACAAGGTGACGGTGAAGCCGTACAGCGCCATCT
TTTCCGATGCCACCGAGCTCGCAACAGCAGCAGCGACCGCGACGGAGGCTGCCGGCACCGTATCGGTACGACCGAAGAAG
TTCCTTCTTTCCAGCTCCGCGTCATGGGCTTTGAATCTGGCGCTCGGAGGAGAAAAATCTGTGGAGGAAGTCCGGAGTCC
GATCGGCGACGCCAAGGCGATCAAAAACGATACTGAGCTCGAGGGTATGCGCCAGTGCCACATCCGCGATGGATCTGCGC
TGATTGCATACTTTGCCTGGTTGGAAGAACAGCTCCAGAGTGGAGTGGAGCTGGACGAAGTGACAGCATCCGACAAGCTG
GAGGAACTGCGGTCAAAACAAGAGCGCTTCGTCGGCCTGTCGTTTACGACGATTTCGTCTACCGGACCAAAGTATGGGCT
CACCTCGAGTTGGGAATTCCCGATCCGTTGAAGTTTTGCTAACGTGTATAGTGCTGCTGTCATCCACTATCAGCCTGAGC
GGGGGAGCTGTTCGATTATCGATCCAAAGGCGATCTACCTGTGTGATTCGGGTGCGCAGTATCTGGACGGGACGACGGAC
ACCACACGCACGCTTCACTTTGGCACACCGACTGCTGCCGAGAAGAAGGCGTACACGCTTGTGCTGAAGGGAAACATTGC
GCTCGACGTGGCTATCTTTCCCAAGGGCACAACTGGATTTGCGCTGGATGCACTTGCACGGCAGTTTCTCTGGGTACGTC
CACCGTTACATCATTTCACAGGATACTGGTTTTAGTGTCTGACATTGAACGCTATACTTTTACAGAAAGAGGGCCTTGAC
TACCGTCACGGAACCGGTCATGGCGTCGGCTCGTACCTGAATGTGCATGAAGGACCAATTGGCATTGGCACCAGAAAGCA
GTATGCCGATGTGGCATTGGCGAGTGGCAACGTCACGTCGATAGAGCCGGGCTTCTACGAGGACGGATCATATGGCATTC
GTATCGAGAACATGGTCATTGTCAAGGAGGTGGAAACGACGCACTCGTTTGGGGACAAGCCGTACCTTGGATTCGAGCAC
GTCACAATGGTGCCGTACGCCCGGAGCCTGATCGACGCAACGCTGCTCACTGAGCAGGAGAAGAAATGGCTCAACGACCA
CCATGCCGAGATCGTGAAGAAGACACAAGGGCTCCTCCAGGACGACGAACGGGCATTGGCATGGTTGATGAAGGAGACGC
AGCCACTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62