GenePrediction:GLEAN_1185 Details

Name: GLEAN_1185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1175240..1176616 (+ strand)
Length: 1377
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1175240..1175329 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:1175390..1176421 (+ strand)
Length: 1032
Type: CDS
Source: GLEAN
Position: GCSC_173:1176485..1176616 (+ strand)
Length: 132
>GLEAN_1185 class=GenePrediction position=GCSC_173:1175240..1176616 (+ strand)
ATGGCTGCCCGCACGCTGGAAGCTCGCTTTGAGCACATGACGGTGAACGACGAGAACGACGACGTCGGCCGGACGTATCA
GAAGACCAAGGTGAGTAGCAGCGGTCCTGTGGTGTGGCCAGATCCAGCTGACACTGTCTACGATTGGCAGGCCGTCCCAT
CCTCGTCCCAGACGGCGAGGCCACAGTACAAGGTGGCCCTGCAGATGCAGAGCGCCAACACGTCGGCGGCGGCCCACCAG
CGCAAGGCAGCCGCTACAGCCACGGCATCGACGACATCGTCGCCACCCAAGGCCAAGAGCCGTAGCCGGGCAGCACCGCC
GGCGGACGAGTCGACGACCAAAACCACGACGGCCGAGTCCGAGGCCCCGGCTGCATCGCCGTCAGTGGTCGGGCCACCAG
CCACAGCGGCTGCCTTTGCGCAGCCGCGACAGTTCCACCTTGGCATGTTCGAGATCGGCCGGCCGCTCGGCAAGGGCAAG
TTTGGGCGGGTGTATCTCGCGCGCGAGCGCAGCAGCGGCTTCATCTGTGCGCTCAAGGTGCTCTACAAGTCGGAGCTGCA
GCACGGATCCGGAATGGAGAAGCAGGTCCGCCGTGAGATCGAGATCCAGAGCAACCTGCGCCACCCCAACATTCTCAAGA
TGTATGGCCACTTTTACGACAGCAAGCGCATCTTCCTCATCCTCGAGTTCGCCGGCCGCGGCGAGCTCTACAAACATCTC
CGCCGCGAGAACCGCTTCCCCGAGTGGAAGGCGGCCCAGTACGTCTCCCAGATGGCCGCCGCACTCGGCTATCTCCACCG
CAAGCACGTCATCCACCGCGACATCAAGCCCGAGAACATCCTCGTCGGCATCCACGGCGAGCTCAAGATCTCCGACTTTG
GCTGGAGCGTCCATGCCCCCAACCACCGCCGCACCACCCTTTGCGGCACCCTCGACTACCTCCCCCCCGAGATGGTCCGC
ATGTACTGCAGCGGCAGCGGCAGCGGTGGTGCCGGTGCCGGCCGCGATAACTCGTACGACGAAAAGGTCGATCTCTGGAG
CCTCGGCGTCCTCACCTACGAGTTCCTCGTCGGTGAGGCCCCTTTTGAGGACACCACCGTCATGACCCATCGCCGTATCG
CCCGTGCCGACATGACTATCCCCGCCTTTGTCAGCCCCGAGGCTCGCGATCTCATCAAGAAGGTCTCTTTTCTCTGTTGT
CTCTCTCCTTGAACACAAAGCACGTGATTTGCTGACTCATTATAGCTGCTCGTCCTCGATCCCGAGAAGCGCCTGTCGCT
GGACCACGTCCAGCAGCACCCGTGGATCCTGAAGCACTGCGTCAAGGGCGAGCGGGCTACCGCCCGCGAGAGTGCCAAGG
AGAGCGCCAAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62