GenePrediction:GLEAN_1186 Details

Name: GLEAN_1186
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1178288..1179832 (+ strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1178288..1178327 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:1178380..1178678 (+ strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_173:1178737..1179007 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_173:1179096..1179832 (+ strand)
Length: 737
>GLEAN_1186 class=GenePrediction position=GCSC_173:1178288..1179832 (+ strand)
ATGAAGGGACAGCGGCCCCTCGGTATCGTCATCAAGCTGGGTGAGTCATCCTGTTCTGGCGCCGCGCACAGCGTGCTCAC
ACCTCCTCGCAGGGACAAGCTCCATTGTCGATGCCACCAGCCATGAGCCGCTCCTGTCCACGCTCTCGCTGATAGTTGAG
ACGGCCGTCCGGCTGCGCAAGGATGGCCACCGCGTCGTCATCGTGTCCTCTGGTGCCATCGGTGTCGGCCTGCGCCGCAT
GGACATTGACAGCCGGCCGAAACACCTGGCCAAGCTGCAGGCCTTGGCTGCCATCGGCCAGTGCCGCCTCATGAGCCTCT
GGGACTCGCTGTTTGCCCACCTGCAGCAGCCCATCGCCCAGATCCTCCTCACCCGGAGCGACATATCCGACGTGCGTGCC
CCTGCAGAGACGGAAGACGGAAGACGGTTGTTGCTGACACCTGTGCCAGCGAACCCAATACCTGCGTGCGCAAAACACGT
TTGCCGAGCTGTTCGACCTGGGCGTCATCCCCATCGTCAACGAAAACGACACGCTCGCGGTCGAGGAGATCAAGTTTGGC
GACAACGACACCCTGTCGGCCATCACGGCCGCCATGATCCACGCCGACCTGCTTTTTCTCATGACTGACGTCGACTGTCT
GTACACCAAGAACCCGCGCCAGCACCCAGATGCGGAGCCCATTGAGATTGTCCACGACATCTCCACCCTGGAGGCGGATA
GTGCGTTCACCTTCCCCGTTCCCTGTTCCCCTTTCTTTTTCCGGGCCCTTGTTTTCCGTTGCCCCTTTTTCCTGCTGACT
CGAGACAGTCTCCACACCCGGTTCTGCCCTGGGGACAGGCGGCATGTCGACCAAGATTGTAGCTGCGCGCCTAGCCACTT
CGGCTGGCGTGACCACCATCATCACGCGGTCGTCGACGCCGGGCAACCTGGTGCAGATTCTGGCGCACGTCACCGGCGGT
GCCTCATCGCCATCGCCATCGTTGTCGTCGTCGTCGGCGTCGCCGGCGTCCGCCAAGGTCCCCCTGCACACGCGCTTCCT
GCCGTGGCCCGAACCGATCCGTGACCGCTCGTTCTGGATCCTGCACGGGCTCAAGCCCCACGGCACCGTATACATTGACC
AGGGCGCAAGCCAAGCACTGCTGGACCACGCCGGCCTGCTGCCCGTCGGCGTCGTCGACGTCGAAGGCCCGTTTGCCGAG
GACGACGCCGTGCGGCTGGTCGTCGTCGACCGCCGTCTGTTGCCGCCTGTTGCCTCCCTTGCTGCCGGCATCGAGGTCGG
TCGCGCTCTCGTCAAGTACTCGTCCACCGAGATCGCCCGGATCAAGGGCCACCGCAGCGCCGACATCGCCAGCATCCTCG
GCTACGTCACCAGCGAGTACATCGCCCAGCGCGAACACATCAGCATGTTCCGCACCAAGGACAGCCGCCCGGCATCGCCG
GCCCTGCACTCGTCACCTCGCTACAAGGGCACTCTCGGCACCGCGTCCCCGCTGGCTGAGGGCCCGGTTCTCGGCGTCGT
TGCTGGCCAGAAAACGGACGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62