GenePrediction:GLEAN_1188 Details

Name: GLEAN_1188
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1187941..1188600 (+ strand)
Length: 660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1187941..1188054 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_173:1188124..1188150 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_173:1188226..1188600 (+ strand)
Length: 375
>GLEAN_1188 class=GenePrediction position=GCSC_173:1187941..1188600 (+ strand)
ATGGACCTGCCAGGCCTTCCTGCGGTCAAGCCGCCTGTCTCTCCTGTGGCTTCTGCCGGGACAGCCCCCATCCCGGTTCA
GTTTCCCCGTGTCGCCATACAGTTCTGCACGCAGGTAAGCCTTTGTCAACCGAGACGCACGAGTTAGTCGTGACCAGATG
CCGACATGCTGACATGCCGACAGTGCAAGTGGATGCTGCGCGCTGCCTACGTAGGCCTCTCCTCCCTATTTTGCCGTTTT
CGTTTTGACAGAGCGCCTGTCCTGTCTGACATGCTTCTTGGATAGTATGCCCAGGAGCTGATGTCCACGTTCGGCACAGC
ACTCGGCGAGGTGGCCCTGCAGCCGGCCACCGGCGGCGTCTTTCGGGTGACCATTGAGCAAGGCACTGCCACCGGCACAG
ATACAGCCTCCAGTCCGGCCCTGCTCTGGGACCGCTCCGTCGACGGCGGCTTCCCGGAGACAAAGGAGCTGAAGCGGCGC
GTGCGGGACGTCATTGCCCCCGGCAGAGATCTCGGGCACGTCGATCGGGCAGCAGCAAAAGAGGCAAAGAGTATATCCGC
TTCGGCTCCGGCATCAGAATCGACAGCAGCCGCAACATCGCCTTTGACGGAGACAAGGAAGAACAATATGCCGGCACAAG
TGTGTGAGGACTGCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62