GenePrediction:GLEAN_1189 Details

Name: GLEAN_1189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1213101..1213767 (+ strand)
Length: 667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1213101..1213241 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_173:1213291..1213767 (+ strand)
Length: 477
>GLEAN_1189 class=GenePrediction position=GCSC_173:1213101..1213767 (+ strand)
ATGGGACCCTCACCGCTCGAGCTGACCCTTGTGGTCGCGGCCACGGCGCGTGACATGGGCATCGGAGCCGCTGGCGGGCT
GCCGTGGACGGGCCTGCGCAAGGAGATGGCGTATTTTGCGCGAGTGACCAAGAGGGGCGAGGTGGGTGCGCATCTCTGTG
CGTGATGACTTTGGCTGACCGTGCGTGCAGGGGAACGCGGTGATCATGGGGCGCCGCACGTGGGACAGCATTCCGGTCAA
GTTCCGGCCGCTGCGAGGGCGGCTGAACGTGGTGATCAGCCGGTCGTTTGCGGCGGGCGTGGCCAAGGAGCCAGAGGGCG
GGCCAGAGATGGGCCCAGTCGAGGCATCGTCGCTAGAGGCGGCGCTGGACTACCTGCGGGGACAGCCAGGCAGCAGCCGG
GTGTTTGTGATTGGCGGAGCGCAGATCTACGCGGCAGCGCTGAATCTAGCCGAAGCACGGCGTGTGCTGCTGACGCGCGT
GACGACAGACTTTGACTGCGACACACACTTCCCGGTCGTGCTGGGGGGGACAGAGGGCAGAGAGACGGGGTGGCAGCGAC
GAAGCCGCGAAGAGCACAGCCGGTGGATCGGCGAGGAGGTGCCGGAAGGCCCGCAGACGGAGAGCGGAACAGAGTACGAG
TTTCAGATGTGGGAGAGAGTAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62