GenePrediction:GLEAN_118 Details

Name: GLEAN_118
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:814027..816744 (+ strand)
Length: 2718
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:814027..816744 (+ strand)
Length: 2718
>GLEAN_118 class=GenePrediction position=GCSC_179:814027..816744 (+ strand)
ATGCGTTGGTCCACATTATTGGCCCTCGGCTCTGTGGCCGTCGGCTCCGTGGCTGCCAGCCCGGCTGCTCCTCCTCCGGC
CAACCACTACTACCCTCGCTGGCGGCATCATCATACCAACACCACCACCACCGTGCCGCCGACGTCGAGCATCGAGGAGA
CCACCTCGACGGCGCCGCCCTCGTCCATCACGCCGTGGACGACGACGCCTGAGATCGACGTGACCGTCACGGCCACTGTT
GAGACCACCATCAGCTGCTCGACCTTTACCACGTCCGGCACTACCTTTACCGTCACCTACACCACCACCAACACGATCCC
GTGCCATGAGTGCACCAAGACCAAGTCCACCGCCACCGTCCCGACCGTGCCGGCGAGCAGCAGCACGTGGGTTAGCAGCA
CTCCGAGCAGCAGTGTTTGGTCTACTACGTCGACGGTTGAGAGCAGCAGCACTCCCAGCGTTTGGTCCACGTCTGTTGCG
AGCAGCAGCACTCCCAGCGTTTGGTCCACGTCTGTTGCGAGCAGCACCACTCCCAGCGTTTGGTCCACGTCTGTTGCGAG
CACCACTCCTAGCGTTTGGTCTACCACATCCGTCGCGAGCAGCAGCACTCCTAGCGTCTGGTCTTCCAGTTCCAGCAGCA
TCCCGACCGTTCCTCTAAGCACTGCCCCAACCACGGCTCCGATCACTCCCACCACTGCTCCCACCACTGCTCCCACCACT
GCTCCCACTACGGCTCCCTGGTCCACTGTCCCGGTGACCAACGTGACCGTCACGTCGACCGTTGAGACCACCACCAGCTG
CTCGACCTACACCTCGTCTGGCACCACCTACACTGTCACCTACACCACCACCAACACCGTTCCCTGCCATGAGTGCACCA
AGACCAAGTCGACGGCGACGAGCTCTGTGCCGGTAAGCAGCCCGGCCAGCAGCACTTGGGTAGTCAGCACCGTCTCCGTG
CCGCTGTCCACTGGCCCCAAGTCGACGCTGTCCACGGTGACATACACGCCGTCTGTGCCCCTCTCCACCGGACCGTCGAC
GACGCCTGTTCCTTCGACCGTCTGGACCCTGACGACGTCTTCGGCCTCCTCGTCCGCCTCGTCGACCATCACGCCTACAA
TCTCCGTCCCCCTCACAACGGCTCCCGGCACGACGCTCTGGACCGTCACCACGCCGACGACGGCACCGTACTTCAACCAG
ACGACGACAGTGACGTCCGAGTCGACTGTGCCGTGCACCACGTCGACCGTCACCTCGGGCAGCTCCGTCTACGTGACCAC
CATCACCCTCGAGACCACCACCACGGCTCCCTGCACCACGGCCACCGTCACGTCCAACGGGTCGACCTACGTGACCACCA
TCACGTCGACGGCCACCACCACGGCCCCGTGCACCACCTCGACCGTCACCTCGAGCGGCTCCACGTACCTGACCACCATC
ACGTACTCGACCACCACCACAGCACCCTGCACCACGTCTACCATCACCTCGGGCAGCTCTACCTTTGTGACCACCATCTA
CTCCACGTCGACCGTCCCGACCGTTCCGACCGTCCCGTACACCACAGCGACGGTGACGTCGAGCGGCTCGACCTTTGTGA
CGACCGTCTACTCCACCACCACCTCTACCGTGCCGTGCTCGACCTCGACCATCACATCCGGCAGCTCGACCTACGTGACC
ACCCTCTACTCGACCACGACTTCGACCGTCCCCTGCACCACGTCCACCGTGACGCAAGGCAGCTCGACGTACGTCGTCAC
CATCACGCCATCCACCACTCCATCCACGCCCTTGACCACGCCCTCGACCACGCCCGTGGTCCCGACTTCGGCCACGGTCA
CCATTGGCAGCTCGACCTTTGTCACGACCTTCTCCTCGACCACGGAGACGGTGCCCTGCACCACCTCCACCGTGACGTCT
GGCAGCACGACCTACGTGATCACCATCACGCCCTCGACCACGCCGTCTACGCCCTCGACCACGCCGTCTACGCCCTCGAC
CACGCCCGTGGTCCCTGCCACGTCTACCGTGACGATTGGCAGTTCGACCTTTGTCACGACCTTGTACTCGACCACCGCGA
CAGTGCCCTGCACCACATCGACAGTGACCCTTGGCAGCTCCACCTACCTGACCACCATCACTCCGTCGACCACGCCGTCC
ATCCCGTCGACCACGCCGTCCGTCCCGTCGACCACGCCCGCGGTCCCGACCACCTCCACCGTGACCCTTGGCAGCTCCAC
CTACCTGACCACCTTCACGCCGACCGTCCCGGCGACGCCCGTCACCACGGCCACCTCGACGGCTCCGACGGCCTTTACGA
CCTGCCCCTGCTTCACGGCGACGACCTGCGTGATCATCGGCGAGACGGTCGCGTCGACGACCGTGTCCGACTGCCTGCTG
GTGCGCGCCACCCTCGTGGCCGCGACCGTGTACGACAGCGTGCTCGTCGACGCGGACGTGCGGGCTGGCTCGTCGCTCGT
GGGCGTGCGCCTGACCGGCGGCTCCATCGCCAACGCGACCGTGCACGATGCCGACCTGCAGAACGTCACCGTGGCCGACA
GCGCGCTCACGGCCGTTCGGCTGCAGGGCTCCAACATCAAGGGCGCCGTCAGCGGCGTCGAGGTGCTCGCCCAGGGCATC
GCCCTCGTCGGCACCGACGTCACCTTTGACTGGGACGCCGACAGCCGCGTGCAGAACGAGACAACCGCGGCCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62