GenePrediction:GLEAN_1190 Details

Name: GLEAN_1190
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1216970..1219636 (+ strand)
Length: 2667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1216970..1217765 (+ strand)
Length: 796
Type: CDS
Source: GLEAN
Position: GCSC_173:1217818..1218572 (+ strand)
Length: 755
Type: CDS
Source: GLEAN
Position: GCSC_173:1218643..1219090 (+ strand)
Length: 448
Type: CDS
Source: GLEAN
Position: GCSC_173:1219149..1219636 (+ strand)
Length: 488
>GLEAN_1190 class=GenePrediction position=GCSC_173:1216970..1219636 (+ strand)
ATGGCAGGCCAGAAGGGGAGCCGTGATGGTATGGTGTCGCCATCTGCCGGTGGTCACGACCCGGACTCAGCCGCAGACGA
CACGCAAGTCCAGTCCAAGGCTGGCCGCGCGCACCGTCTCTCGGCCTGGGGCGAGTCTGCCGCCGGCATGGCCCACGATG
CATTGCATCACGCACGTGACGACGACGACGATGGGTCCGAGTACGAGCTGCTGCTGGACCCAAACCTGCCGGAGGAGTAT
GGGCCAGGCTTCGACGACGCCGAGGCCAAGGTGGGCGAGGATGGCGAGGAAGGCGAGGACGACCAGAACCTCATTTCGTC
CTCGGTTCCCGACGACTCGCCGTATCCCGAAGTTCGTGCGGCCGTTCGCAACTTTGACGAGGATGTGCCGTGCAACACGG
TACGGGCCTGGACCATCGGACTCTCGCTCGTCGTCGTTGGTGCGTCCATGAACACGCTCTTCTCGCTGCGACAGCCGTCG
ATCAGCATCGGGACGCTGGTGGCCCAGATCGTCGCCTGGCCACTGGGCCACGGCTGGGCTCGTGTCATGCCACGTCGTCG
CTTCCGCACCTGTGGTCTCGTCTGGTCGCTCAATCCGGGACCCTTTACCATCAAGGAACACGCCATCATCGTCGTCATGG
CCGGCGTCTCCTTCTCTGTCGCCTACGCCACCGACATCATCCTGGCCCAGATCGTCTTCTACAAGCAGGACTTTGGCCTC
ATCTTTCAGCTGCTAATGGTCGTCTCGTCGCAGTCCTTGGGCTACGGCATTGCCGGTCTGATGCGCAAGTTTTTAGGTGA
GCACTCCCTCGGCCTGTTTCCGGCCTCCTCCTCCTGGCTGACCCCCAGTCTATCCCGCCGCCATGATCTGGCCCGGAAAC
CTCGTCGCCGTCTCGGTCATGAACGCCATGTACGAGCAGTCGCCCAAGGCCGACCCATCCATCCTCGGTGGCTCTATACC
GCGCTATCGCTGGTTCGCCTACGTTACCCTGGCCGCTGCCGCCTACTACTTTGTGCCCGGCTTCCTCGCCCAGTTCCTCA
GCGTCCTGGCCGTGCCCACCTTTCTCGCCCCCGACAGCATCATCGTCAACCAGCTCTTCGGCGGCCAGACCGGCCTCTCG
CTGCTGCCTCTGACCCTCGACTGGACCCAGATCGCTGGCTTCGTCGGCTCCCCCCTGATTCCGCCTTGGCACGCCATCGC
CAACACCCTCATCGGCGTCGTCGTCTTCTACATGTTTGGCGCCATCCTGCTGCACTACTCCAACGTCTGGTACGGCCACT
TCCTTCCGATCAGCGATTCCGCCACCTACGACAACACTGGCGCTGCCTACAACGTCAGCCGCGTCCTGACCGCCCAATTC
ACCCTCGACGAACCCGCCTACCGCGCCTACTCGCCCCTCTTCCTCAGCACCACCTTTGCCATCTCCTACGGGCTCTCTTT
TGCCGCTATCGCCTCGCTACTCGTCTACACGTACCTACACCACAGCGGCACCATCTGGCGTCAGTACCGCAACAGCACCA
ACGAGAAGCCCGACGTGCACATGCGCCTGATGCAGCGCTACAAAGAGGCCCCGAGCTGGTGGTATTTCTCTCTGTTTGTG
TTGGTGAGTTGTTTTTTTTCCTTTCCTTCCTTTCTTTCTCTCTTCCTTCTTCTCTCTTCCTCTCACACTACAGATGCTCG
TCCTCGGCTTCATCACCATCCTCGCTTATCCTACCAACCTGACCTGGTGGGCTTTCCTCCTGGCCGTCGTCATCTCCTTC
GCCTTCGCCCTGCCCATCGGCATCATTCAGGCCGTCACCAACAACCAGATCGGCCTTAATGTCCTGACCGAGTTCATCTA
CGGCTACATCCAACCTGGCCGTCCGCTGGCCCTCATGCTCTTTAAAACCTACGGCTACATCACCATGTCCCAGGCCCTCA
CTTTTGTCGGCGACCTCAAGTTTGGCCACTACATGAAGATCCCTCCCCGCACCATGTTCATGGCCCAAGTTGTCGCCACC
ACCTTTGCCTGCTTCATCCAGGTCGCCGTCCTCAACTTTGCCCTGCAGAACATTGAGCACGTGTGCGAACGCGACCAGCC
CGACCACTTTACCTGTCCGGGCGGCCGCGTCTTCTTTTCCGGTGAGTTCTTCGTGCCGGCTTTGTTCATCACCATCCTTC
TGCTGACTAATCTCTCCAGCCTCGGTCATCTGGGGCCTGCTCGGCCCTGCCCGCATCTTCTCGCCCGGCCAGATCTACGC
CGGCCTGTTCGTCTTCTTCATCCTCGGCGCCATCGTGCCCATCGCTATCTACTACGCCGCCCGTCGCTGGCCGCGATCGC
CCGCTAAGTTTCTCATGGCGCCGCTCATCTTTGGCGGATCCGGGTCGATCCCGCCGGCCACGCCGCTCAACTATCTCAGC
TGGGGCATCGTCGGCTTCATCTTCCAGTATTGGATACGCAAGCGCCACTTTGCCTGGTGGAGTCGTCTCAACTTTTTGAC
CTCCTCGGCCCTCGACCTGGGCCTCGCCCTGAGCACCCTGGTCATCTTCTTCGCCTTCACCCTCAACGACATCAACGCGC
CCGACTGGTGGGGAAACTCCATCGTCACGAGCACCATGGACTACAAGGACACCGCCGTCCTGAAGACCGTGACGCCCGGT
GAGTTCTTTGGGCCGACCGCCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62