GenePrediction:GLEAN_1191 Details

Name: GLEAN_1191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1232669..1235049 (+ strand)
Length: 2381
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1232669..1233004 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_173:1233070..1235049 (+ strand)
Length: 1980
>GLEAN_1191 class=GenePrediction position=GCSC_173:1232669..1235049 (+ strand)
ATGTCTGTACCTGCAGACCTGCGGGTCTTGTGCCGAAAGCTGGTAGCAACAACACCTGGAGACTTGCCGGCCTTATGTCC
TATTCTTGTAAACCACATCCTCAGATGTGGCAGTCCGCTGTCGGCCTCGGCCGAGCAGCACAACAAGAGCAGTTCCAGTG
AGGCCTCTGTGCTCGTTCACAAGCTGAAGACCCAAGTCAATGCCCTCCTTCATGGGAAGAACGCTCATGGGCGCTTTGCT
GGCATGGTCCTGGCCAAGGCCATCATAGACGTTGGCGGTTGGGAATGCTTACGAACATCCGAGAACTGGGTTCGCGGCCT
ATTGTCCATTCTGCAGGTATGTCGGCGACAATTCGCGTCTCTCTCACACTCAGAGTCCCCTTGAAGCTAACGGTCTCCAA
GAGACCTGATCCGTTTGCCTCCAAAGAGTTGTGTGTGGTAGTCCTGGCAAGGATCTACACGTTGCTTCAGGAGTTCCCAA
CGCTGGTCCGCGAGATTGCCACCCCCACTGTCCCGTCGTTCGCAACGGCCTGTCTGCAGCTGCTGCGGCCAGCAGCTCCC
GGGAAGCCTCCCAAGGCTCCTGCGAGCGTGATCGAGGCCGTGACCCGCGCGCTGGCCGCCCTGATTCCTCACTATCCGAC
GACACTGCGGCCGTTCAGCGTGCAGATCCGAAATGCCGTCCGCGCCTACGTGGCACCGACTGCCTCGGACAGCATGGTCG
TCCCGCCCTCCCTCAGGCAGAGTTCTCGTCGTCTGCTGGTCCTCCTGCACTATACGGCTCCGAAGAACAACCACGCGGAC
GAGTGGTCCAAGCTGCTGAACGGCCTCATCCAGGACGTTCATGTCACGGCCGACCAGGTTTTCCGGGCGGTGCGGGAATC
GACAGATCCGGGCTCGGAATACATGCCTGGCGAGGTGTCGTACGAAGGACTGCCAGAGGGTGGAAGCGACCTCTCCGACG
ACTTTCCTAGCTGGACGGGACTGCAGAGCGGCGCCGAGCGGCTGGCCGGCCTCCTGGACTCGATCACAGAGGTCTTTCGC
TGCCCCACCAAGGCTTCCGTTGCCGTGCCGCTGGGGAGAATCTCGAGCCTTGTCTCCCGCATGTCGCTGGTCCTGCCTCC
TGCTCCGGGCAGCAATGAGCGGGACCATTCGTCGCTGATCAATCCGAGCATCGGAAGGGACGAGAGGGACGAGCTCTGGA
GTGCCCTGCCAGAGATACACGTTGCGGCCGTGGGCCTGCTACAGAGCGTGGCCAGGAGGATGGGTGCTCATGCCGTGCCT
CTGGCGCCAGAAATGCTGGAGGATGCCGTGCGCATGTTTTCTTCCGATCACCACGTCCCGCTGATGCGGCAGGTGACTTT
TTCACTGGTTCAGAGTCTTCTGCCGTCGGTTGGCCCTTCCATGTCCCGGGCTACTGTGGGCTCTCTGGGCGTCGTCGTGC
ACGCTTGCTGCCAGGACATTTTGGAGGCCTCGGGATTCGCGCAGCGGCAGGAAAAGAAGGACGTCGCTCCGGTTAAGAAC
GCCGTCAACATACCAAAGAATAAGCTGGCAACCGCCAACGCCGACCTCTTCTTGAACCCTAGCCAGGCCACCACCTCGTC
GACCGCAGCCGCTTCCACATCCGAGTTGGAGGCGGCTCACCTGCGCGCGGCCCAGGACCTCCTGTCTTCCCTCCTGGCCC
ATCTTCCCCAGCAGCACGTCAGAAAGGCGGACCGGGCGCTCCTTGACCGCACCGCCATCCTCAGTGCCAACAAGGAGGCC
ATGCTGTCTAGCGTGTTGCATCCCTACGTCGACCGCAGCGGCCGGTACTTTGCCAACACCATCCCATTCCTTGCACGTGC
TTTTCCAAACGATTTGGACTTGGAGGTCCTGCGAAGCAACCTGCGAACGGCACCCCACTACTTTGGCGACATCTTTGCGA
TGGCAGCTCCGGGCACTGTCAAGGACGAGGAGGACGGCGACAGTGACGAGGAAGTCGACGACGAGAGAGGACTGCTGTCC
GGCCTGGATGCAGCCATCATGAACGGAGAAGAGGACGTGCTGATGGGTAACGGTGAGGACGGCCCGATGCCCGCGCCCTT
AGACGGCGCCGGTGGCTTTGGCCTCCAGACTGCCTTTGCAGAACGGAGCAAGCCGGCCGACGAGGCAGCTGTCCAGCCGG
CGACAGCTGTATTTGAGCCGCTGACGCTCAAGCGGAAGATTGAACAAGACGAGAATCTAGCCAGCACACCAAAGAGACCA
GACACGAAGCAGACGACCCTGGACGCCGTCAACGACGGCAGCGACGCTGGTGACGATGACCAAGACAACGACAGCGATGG
CAGCGTCCAGCTGGACATGGTTTTTGACGGCGAAGATGACGAGGAGAGCGGGAATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62