GenePrediction:GLEAN_1192 Details

Name: GLEAN_1192
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1243457..1246240 (+ strand)
Length: 2784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1243457..1244452 (+ strand)
Length: 996
Type: CDS
Source: GLEAN
Position: GCSC_173:1244715..1245660 (+ strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_173:1245728..1246122 (+ strand)
Length: 395
Type: CDS
Source: GLEAN
Position: GCSC_173:1246193..1246240 (+ strand)
Length: 48
>GLEAN_1192 class=GenePrediction position=GCSC_173:1243457..1246240 (+ strand)
ATGCTGCAGGCACAGTCATCATCTGCGGGTGGGATTCTCCCCATGCCCCAGGGACAGCATGGACAGCAATACCCAGCGTC
GCCGCAGCGACAAAGCTTTTACGGAAGTTCTAATGGCGTATCGGGCACTCAAATGGTGTACCGCACAACACCGGCTCCGA
TCCAGCCATACGCCTTCACATCGACGCCTAGTCTCCATACAAACATGCCGAGGCAGCAACCACAGCAACAAATTCCTCAA
CCTACTACAATGCGAACGCCTTCAGTCGCACCATGCCTTCCTCAGCTGCAGAGTTTTGACAGTTCGATCAACCTTGGAAG
AACGGTGCAGCAGCCTGCTAGTGCCTCTATGAGCAACCTGTCGACCAGCTCAACCGTGTCCGGTGGCCGATACACCTTTG
GCAGCCGTGATGACTCTTCACTGCCAACAAGTCAAGGCACCAAAAGAGTTGCTGCCTCTCAGACTTCAGCGGCATATCCA
CCGGGCACACAGTCTTTTGCTCAGGCTGCGTCTGCTCGTGCGTCGCCAGAAAGATACCGACGGGCAATGCCTCGGACTGT
GACAAGTCCGGCTGTCTCAGTGCAGGGACAGCAACAGAAACCGGCGTCGGCCGCACCATCTGGTTCTGGGATGGCTAGCA
TTGGCCACCTCTACGGATCGAGTGTTTCCAGCGGGCTATCACAACAGCAGCTGAATTCGAATCGCCGAAACAGTTGTCAC
GATGCTGCGTTGACAACTGTCGATGACATGCAGCTGTACCGTCCATCGGACGATGCGAAGCGAATTCGACGCCGCAGCAT
GCCTTCGCTGGACTTGACCCACCACGCACCATCGCAAGGGCAGTTCAGGAAGCCTGAGCCGTCTCCGCGAAGTCACGGCA
AGGACAAGCAGAGGGCAGCATCCGGCGGCAATCTATCTCCGGGTAGCGCGATAATGCGAAACAAGGATGGAAGCTCTGAG
AGTGTTTCGAGCCGTGGGAGTTCAGCGCGCCCAGCTGTAAGTGTTGCCCCTGTTATCTGTGGTTACGAGTTTATTTTGCA
CCTATCATGCCTAGTCCTTTTTTTACCCTTCTCCGGACCCCCTGCATGCACTATCTACAACACCCAATCACCCGAGCGTC
AGCATGTTCGTCTGTCGCTAATGCAATGTCTGCTTTTTTTTCTAGTCTACCACCCGGAATTCTAGCGCTACTGCAGCCCC
CACTGTGAACCCCGCTTCCTCAGCCACGACCCTATCTGACAACAACACACCCGGACAGAACAAGGACTCTTCAAAACATG
TCCATATTCCTCAGCGTGGTTCTTCTTCAGATGCTGCCAATCGCGCCGCCGCTTCTGTATCGCAGTCTAGGCCGAAAGCG
ATGGATGTGGCTGCAGATGGCGACAAGAGGAAGGTGGCTGCCAACATGACTTCCAACAGAGGCGCCAAGGATGATGCCGG
CTCTACGGCGGACCAGAAGGCTGCGAAGGGGAATCCAAACCTTTTGGAAAGCCCGGCCATGCGTCACTTGTCGGCTATCA
ACCAGAAAGGCGGCAAGGTGCGCAGCAAGACGTCGAGACTTCGTCGGGCGTTTTCCTTTGGCAGCGCGGCAGATTTTCGT
ACTGCCGGGCCCGAAGACGAAGATAGCAGAGATATTGTTGCCCCTCTCGCACCGAGTAGGCTGCACACGGCTCCGGGCAG
CGACGAGATCTACGACGCTGAGCAGGACCGGATCGCACAACGGCAGGAAGAGGCTGGTATCGGAAGCAGTATCTACGCTG
GCGCTAGGATTTTCACTGGGTCTACGGATAACCTGTCGATATCGTCGACTGCCTCTTCGGCGTCGATCATGATCCGTAAG
ATGGGTCGGAACATGAAGAAGGGCACACGATCGTTCGTAGGGCTCTTCCGGCCCAAGTCGATCATCGGTGCGCCTGCTGC
TGAGTCTGGTGTGGCCGGGTCAGGCAAGTCCGGCACGGCCAACACGGCAGAGGCCACTGTGTCGATGGTGACGGCCGAGG
CAGACCGCGAGCGTGGCACTGCAAATAGCGGCGGCTCGGGATACCCCAAGCTGCAGAGAAGCTCAGTTGACGCTTCGGTG
GGGTCAGCGACATCTGATCGTCTCAGCAGCTCGGGAACAGACAACTCGGGACGCAAGAGCATTGTAGGCGGCGAGAGGGA
GCGGGCGGAGGTTCTTGCTGCAGTGAGGAAGGGCATCCTGAAGCGTGAGTCTAGGTGGTGGCGGGCTGTGGCTAGTATGG
AAGAAGCGACGCTAACTCATGAATTTGATAGACGCCAGCGGCTCCCGAAGCCCTTCCCGCGGTCCGGCAGAGGACCGTAG
CCTTGACCTTGAACTGCCGGGCCCACTGCCCATCAACGATTCGCCGGCGTCCAGCGCGCCCAGCACGCCGAACGATGAGT
CGCTCGGGCACAAGCGGACGGGGTCTGTAGCGATTGGCGGCGAGGACTACTTTGTGTCTGCTCTTCGGTTGCGCCAAGGT
AGCCGGAGCGGTAACAGCACGCCACAGGGCTCGATGCGGCGCAATGCGACGTTCAGCCCCCGTATCGTGTTCTACGACAC
GTGGCCGAGCCAGGAATACGATCGCCGCGGAGAGGTTGCTACGTGCAACCGTCTGACGCCGATGCTCGCACAGCAAATCA
AGGAGGAGCTGAACAGCTTCAAGATGGTACGTGCTTCTGTTGTGTGGTCCGTGGGCGTACTTTTCCCGCACATGCTTACG
ATGATGTCTTGTACAGGAAATGGAGGTGCACGAGAACTCCAAGATCTACACACATTTTTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62