GenePrediction:GLEAN_1193 Details

Name: GLEAN_1193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1247775..1249502 (+ strand)
Length: 1728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1247775..1247900 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_173:1247958..1249502 (+ strand)
Length: 1545
>GLEAN_1193 class=GenePrediction position=GCSC_173:1247775..1249502 (+ strand)
ATGGCGAGCTCGACGGCGGCGCCGATTGCCAACGGGCGGGCAGCCAAGCTTCATGGCCGAGCCTTTTACGAGAGCATTGG
CAGCCCCAAGTACATTGTAGCGCCGATGGTGGACCAGTCCGAGTTTGTGCGTGGTTGGCGAGCGAGATGAGCGATACGAG
CGATGAAGCTGACGGTTTGGCAGGCCTGGCGCATGCTGGTGCGGTCGTTCTTGGCGCCGGAGAAGCGGTCATCGGTGCTG
GCGTACTCGCCGATGCTGCATGCGCGGCTCTTTGTCGACAGCCAGCGGTACCGGGAGTCGCACTTTGAGGCGATGCGGAG
CGGCGTGGACGGAGCGGAAGGGATAGCAGCAGCGGCAGCGACGCCGCACCTGGACGGCAACCCGGCGGTGGACCGGCCGC
TGTTTGTGCAGTTCTGTGCCAACGACCCGACGGCGCTGCTGGCGGCGGCGCGGCTGGTGGCGCCGCACTGCGACGCCGTG
GACCTCAATCTAGGCTGTCCGCAAGGAATCGCGCGCAAGGGCCGATACGGAGCCTTTCTGCAGGAGGACCGCGAGCTGAT
CGTACGGCTGATCCGGGCGCTGCACGAGGGCCTCGACGTGCCGGTGACGGCCAAGATCCGCATCCTCGACACGCGCGAGG
CCACGCTGCAGTACGCGCAGGCGGTGTTGGCAGCCGGCGCCAGCATCCTGACCGTTCACGGCCGGCGACGCGATCAGAAA
GGTCACCTGACCGGCATTGCCGATTGGGCCACGCTGCGGTTCCTGCGCGACAGCCTGCCGCCCGAGACGGTGCTGTTTGC
CAACGGGAACGTGCTGCAGCCGCGCGACCTGCAGCGGTGTCTGGATGCGACCGGGTTCGACGGCGTGATGAGTGCCGAGG
GGCTGCTCTCGGACCCAGGACTGTTTGGGAGTGAGCCGGCTGGCGATGCAGACGATGCTGCAGAAACAGACACAGCCACA
TTCACAGCCACAGCTTGGTGGCCTACGCCCGATGTTCAGCGCGAGTACTGGACGAGTCGTGATGGCCAGCGCGGTGGCTG
GCGCGTGGACGCGGTGATGCGTCGCTATCTGGACCTGCTTCACGTGTATGCGCTGGACGAGACGGTGCCGCCCCAACGCC
GGCCGCTCTTTTTGCCGGGCGACGAGCCGCTACCAGCGGAAGAGGAGACGAAAGCGAACCCGAGCACGAGCGAGGCCACG
GACGAGACCGGCGATGCCGCCGAGCCGCGACGCAAGAAGCGCAAGCGGGACGAGATGCAGCCGTCGTCTTCGTCGTCGGC
AGCGGCGGCGGTCTTCTCGTCGCCCAACTTTGTCGCCGCACAGGCACATCTGTTCCACCTGCTGCGCCATGCTGTCGGCC
GTCACCACGACGTGCGCGATGCGCTGGCCCGCTCTCGCAAGGGCGACATGGCCACCTACGAACGCATCCTGGCCATGCTG
GAACACCGCGTGGCTGCCGCGCTGACCGCCGAGGCCGCCGACATCACCGGCTCCTCCGATGAGGCCCGCCAGGCCGAACA
GGATCGCGTGCTCGCCGAGGCCAACGGCGAGGACGACAAATGCCCGCGCGACGACCCCGACTCGTCTGCTGCTGCCCTCC
GTCGCTGTCGCCGGCCCTGGTGGGTCGTACAGCCGGTGCTGCGACCTATGCCGGCCGAGGCGCTCGCCAAGGGCGCCATC
CAGCTCAAGAAAAAGGACAGGAAAGGAGACATAGAAAAGGTCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62