GenePrediction:GLEAN_1194 Details

Name: GLEAN_1194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1252512..1252926 (+ strand)
Length: 415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1252512..1252514 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_173:1252587..1252667 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_173:1252738..1252926 (+ strand)
Length: 189
>GLEAN_1194 class=GenePrediction position=GCSC_173:1252512..1252926 (+ strand)
ATGGTGAGTCCTGTCTCTCGGTCCTGATCAATTTCTCTTTCCTCTTTCCTCACACCCACCGCTAATACACCCCAGCTCGA
CAAGCTCGTTGGCCTCGCCATGCTCGTGGCAGCCACCGTCGTCTTCCTCTACTACACCGTCTGGACCCTGCTGATGGTGA
GCAGCTGCGCCGTCTCGGCCTTGGCTTCTTGTGCTTCCTGTTCTTCCTGTGCTAACCGCGGCCCAGCCATTTGTCGATGT
CGACCATCCGCTGCAAAACTGCTTTCCCCCGCGCGTCTGGGCCATCCGCATCCCCGTCATCCTCATCCTGCTGGGCACCG
CCGTCGTCGGCTCCTTCCTCAGCATCGTCATGATCCGCAGCAACCGCAAGAAGGCGGCCAAGTCCAAGGTCACGGCCACC
AAGAAGAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62