GenePrediction:GLEAN_1196 Details

Name: GLEAN_1196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1275345..1275794 (+ strand)
Length: 450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1275345..1275395 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_173:1275463..1275590 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_173:1275653..1275794 (+ strand)
Length: 142
>GLEAN_1196 class=GenePrediction position=GCSC_173:1275345..1275794 (+ strand)
ATGGCTTCCACAATTGCTATAGGGACAGGCGTGGCCGTTGCGGCTTTTCTCGTATGTCAACGGCGCCCTGCATCTTGCGA
CAGCATCCCGTTTATTCTCCGCTAACGCGCATTATCAGGGTCGAGCAGGTTTGGTGGCATGGCGACGGTCGCGCGGCGGT
GTCGGCGCTTTAGGCAAGGCTTTTTACAAAGGTGGCTTTGAGCCCAAGATGTCTAAGCGGGAGGCTACGCTCATCCTGTC
ATTGAAGTGAGCCCGAGAGAACGAACACCCACCTATACACCTCTTCCAGTGCTGACGGTCATCTACAGTGAGCGGGCCGT
CACAAAGGACAAAGTTCGCAAGGCTCATCGGAACCTGATGCTGCTCAACCACCCCGATCGTGGCGGCAGCCCATACCTTG
CAACGAAGGTCAACGAAGCTAAGGAGCTGCTGGAGAAGCAGGCCTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62