GenePrediction:GLEAN_1197 Details

Name: GLEAN_1197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1286207..1288503 (+ strand)
Length: 2297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1286207..1286290 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_173:1286359..1286538 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_173:1286590..1286768 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_173:1286825..1286994 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_173:1287138..1288387 (+ strand)
Length: 1250
Type: CDS
Source: GLEAN
Position: GCSC_173:1288456..1288503 (+ strand)
Length: 48
>GLEAN_1197 class=GenePrediction position=GCSC_173:1286207..1288503 (+ strand)
ATGACCAAGATTCTATGTGTTGCCGAGAAGCCGTCCATATCAAAAGCTGTCGCGGGCCATCTGTCGGGAGGACAGTACCA
GACGGTGAGACTTCCTCAAATCATCTTGAGAAGGGCTAGGCTAATCTTGCACAGCACAACACTCGTTCACAGTACATCAA
AAACTATGCGTTCACTTTTGACTTTGGACCGCCATATGGCAGTTGCGAGGTGACAATGACCTGCGTGACTGGCCACATGA
CAGCGATGGAATTAAGCTCTGAGTTCAAGGACTGGAAATATCCTCCACCAGAGCGTCTGTTTGATGCGCCTGTGCAGACC
ATTGTCCCAGATGTATGTGGTAGCTCTTGCAAGCTTCTGACAGATGCGGCTGACTCTTCTCAGGACAAAAAGACCATTGC
GGAAAACATTGAGCGCCAGGCCCGTTATTCGCGCGCTGTCTTCATATGGACGGATTGCGATCGCGAAGGCGAGCACATTG
GCAGTGAAATACGAGATGCTGCCCGTAAAGGAAAGCCTACGATTGAAGTTCGTCGGGCACATTTCAGCAATATTGAGCGC
GCGTACGACAATGTTGACCCTCGACTTTGTTTCCACGCCCCGCTGACCCCCCATCCAGACACATCCTGAACGCGGCGCGG
AGTCTTGTTGCTCTGGATGAGAGACAGGTCGATGCTGTATCTACTCACATCGAACTCGACTTGCGCATTGGTTTTGCGTT
TACAAGGTTTCTAACCAACAATCTACGGGCCTTGGGCGGGCCACTTGCTGAGCTCGTCCTAAGCTATGGTAAGATGCTTG
CTCACACATTTGCCTGGCCTGGCTAACTAACTATTTCGAAGGTTCCTGTCAATTTCCAACGCTTGGATTTGTCGTCGACA
ATTACTTTCGGGTCCGAAACTTTGTTCCCGAACCTTTTTGGAATATCGCAGTTAAGCACACCAAAGACAAAGCCACTGCC
TCGTTCACATGGGCCCGCGGACACCTTTTTGACCGCGCATCCGTGATCGTCCTATATGAGCGGTGCCTGAAAGCCAAGAA
AGCCGAGGTGGTCAAGGTCCAGGAGAAGCCAATCAAGCGGATGCGTCCGCTGCCGCTGACCACGGTCACGCTGCAAAGCA
TGGCCACGCGCTTCCTCCACGTTACGGGTCAGCAGGCCATGACGATGGCCGAAACGCTGTACAACAAGGGCTTCATCAGC
TATCCACGAACAGAAACAGACCGGTTCGACAAAGGTATGAACCTACGTGCCCTCGTCCAGAAACAGACACAGGACCCGCA
GAGATGGGGAGCGTTTGCACGTGGGCTTTTGGACGAGGGCAAGTTTCAATGGCCTCGGAGCGGACAGCATGACGACAAAG
CCCATCCACCCATCCACCCAATCACGTACGCTGCACCTTCTGTTTTGGGCCCGGACGAGGGCCGCCTGTACGAGCTTGTG
GTGCGGCGGTTCCTGGCATGTTGCGCCGATGATGCGAAAGGCATGGCTTCGGACGTGGAGATCGCCTACGGCAGCGAGCG
CTTCAAGGCCCACGGCGTGCACGTGCTGGAACGAAACTATCTGGACGTGTACCCATACGAGAACTGGACGGACACGGCAG
AGCTCCCACCATTTGTGGTCGGTGAGATATTCACGCCTACTGAAGCGGTCATGGCAGAGGGCAAAACAGCAGCTCCCGGG
TATCTGACAGAGGCAGACCTGATCGCGTTGATGGACGCAAACGGCATTGGCACAGATGCGACCATGGCGGAACACATTCA
GAAGATCCAAGACCGGAACTACGTGCAGACGGTACAGTCGTCAACAGGCCAGCAAAATGGGGGCACTGACGATGGCGCGG
GGGCCGGTGGTGCTGGGGAAGCCCGCGGTGGACGAGGGGGACGAGGAGGGCGTGGAGGGCGCGGCAGCAGTCGCGGTGGT
CGAGGCGGAAGCCGAGGGGGAGGCCGTGGAGGCCAACGCGTGTTTGTGCCTACGCAGCTTGGCGTGGCGCTTATCGAAGG
TTTCGACCGCATGAACTTTGAGACGAGTCTGGGGAAGCCGTTTCTCCGAAAGGAGATGGAGCTGCAGATGAAGGCCATCT
GTGAGGGCCGAACGACGAGGGCAGCCGTGTTGCAGGAAAACCTGAGGCAGTATCGCCGTGTGTTTGAGCAGTCGTCAGAG
CGGCTGGATGTTCTGAAAGCAGTATGCATGCCCCCTCTCTCTCCCGTGGCCAGGAAAGTTGCTAATGACCGAATCAATCA
TGGGAACAGTCCTGCAGGCAGTACATATTCAATGGAGGAGTGGCAGCGCCTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62