GenePrediction:GLEAN_1199 Details

Name: GLEAN_1199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1294250..1296226 (+ strand)
Length: 1977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1294250..1294465 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_173:1294533..1294821 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_173:1294884..1296226 (+ strand)
Length: 1343
>GLEAN_1199 class=GenePrediction position=GCSC_173:1294250..1296226 (+ strand)
ATGTCGTCCATTCAGGACGGCGGCAGCCATTCGTCTGGGTCCAACAACGGAACACCAGTGCCCGGATCGTCTGCCTCGTC
AGCCACGCCGCAGTCGTCTGCGTCGGGTGGCAGCGGTGGCAGTATCAGCAGCAGCAGTAGCAGCGGCCCCGAGGACAGCC
TCATCTGCCGCTGGAACCAGTGCAGCGAGCGCTTCACCAGTGCTGAGATTCTCTATGTGAGTGTGGGAAACGAAAAATGG
CGAATGCAAAAACGACCAGCTAACCTCACCTTCTGTCTCCCAGGATCACATCTGCGAGCGTCATGTCGGCCGCAAGAGCA
CCAACAACCTCAATTTGACGTGCCAGTGGAACCAGTGTCGCACGACGACGGTGAAGCGCGATCACATCACGTCACACATC
CGCGTGCATGTGCCACTGAAGCCGCATAAGTGTGATTTCTGCGGCAAAACCTTCAAGCGACCACAGGATCTCAAGAAGCA
CGTCAAGACGCACGCTGACGACTCCGTGCTGGCACAACGGCCGGGCCAGGACCCCACGGCCGGGCTTGGCCCTGCCTACC
GCACACATCCAGGTAGGGACTCGCTCCTCGTTTCAGTTCACCCGTTTGCTACTGCTAACACTGTCGGCCAGCAGCGTCCA
GCTACTATGACCACAACGGCCACATCCGCACAAACGCCCCCCCGTTCGGTCAGCCACACCAAAACGGCCATCCGGGCTAC
TACCCGGCGCAGCAGCAGCAGCAGCCGTACCCCAATAACATCTACTTCCCGCAGTCGCTTCATCCCCGTGGTGATTACAT
AAGCAACCATCAGAGCCACCAGGCACACCATCAGCACCACGCCCAGCCACCGCAGCACCATCTGGCGAGCGGTCCTGTTG
GCGGTGGTGGCGGTGGTGGTGGCAACGGTTACGATCCTCGACGGCGCAACCTGGACGTGATCAACGACTTGTTTGGCGCC
CTGAAGAGCGGACAGGTGAATCCGTCCTCGTACACGCAGGTGGGCCGGTCGCTCGGGCCTCTGCAGACCGGACTGATGGC
CGGTGGCGGCGGTGGCGGCGATGGTGGTGGCGGCGGGTTGGCGACCGACTTCATTGGCGCGGCACAGCCTCCACATATGC
TGGCAGCCCCCCAACATCCCATGGCGCAGCACTACTTTCTGCCACCTATTCCGAGCCTGCGCACGAAGAGCGACCTGGAG
GAGATGGACGTGCTGCTGGAGCAGATGCAGGCAACGATCTACGATAATTCGGGCGCGTCGCCGAATCCTGGTGCGGCCCA
CGGCTTCGACATGCGCGGCAATGCGACGTCGCTCAACCGGCCGATGCTGATCGGTGACCACTACGGCAACACGGCAGCCA
CGGGTGTCTCGCCGCTGACGGCCATGTCTTCGCAGCGTTCCCAGAGCGGTGGCTCGCCGGCGGTGACGCCGCCCTCGAGC
GGCACGTCCTACACGTCGGGCCACTCGCCCGGCGATTCGAGCACGGGCATGTCGCCGTCGATGCGGCAGCTGCCGATGAC
AGGCGTTCCGTCGTCGCTGCCAAACATTGCGTATCCGCAGCTGCCGACGTCGACGGGTGTGGCCTATCCGGGGTCGACCG
CGACGGCGCAGCTCGGGTCCAGCTTCACGTCGGACGATCGGCCGCATCGTGGCGGCATCCTGCAAAGCTCCAGTCGCAAG
GCCAGCCACGACAACAACGACAAAGTGCCGTCGCAGAGACAGGCCTCGGTCAGCTCGCCGTCAGCCGACTCAGACTCGGG
CAGCGAGCCGGAGCTGTACGACCAGTGGCTGAATAACGTGCGGGTCGTCGAAGACCTGCGGCGCTATGTCAAGGACCGAC
TCGCACGGCAGGAGTACGACTACGAGCAGAGCCGGAACCGCAATATGCCGGAGCCACCCACAACCGGACGCACGTTTGTG
AAGCAGGAGTCGCCCATCATGCCGCTGTACCCCGAGCTGCGGCTGTCCAGCGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62