GenePrediction:GLEAN_119 Details

Name: GLEAN_119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:817009..818646 (+ strand)
Length: 1638
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:817009..817120 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_179:817425..817589 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_179:817834..817925 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_179:818233..818646 (+ strand)
Length: 414
>GLEAN_119 class=GenePrediction position=GCSC_179:817009..818646 (+ strand)
ATGCCTCCCGATATCGACTGGACCTCTTCGTGGTATTCATTCATGGCCTCGTACCCCACGGCCTTGTTAGAACTGTTTGA
ACTAGGTCTGTGGCAAGAACGCTGTGGTGATGGTATGTAAGGCAAGCCAGTGTTAGTCCAGTCACGTGATATTTGGCAGT
TACACGGCTTTCTGCATGAGGAGCCACTCGGAGAGGCGGGTCACCACCGAGAAAGAGGAATTTGACTCTTTCACCGGTGA
AAAAGTTGCTTCATTCTCTGCAGTGACCCACATGGTCACGTGCAATATCCACCTACTCGTACGGATCACTTCTTCCCAGT
CTTATTCCGTACTATGTTGTTCTACTCCGTACACGAGTACTCAACGTAAACATTGCATCTTTCCCAACGACATTGTGCAA
AAATCAATCTTAACAGAATGGCTTCACCGGGACACCGGCACCATGGAAGGCGTCATTGACTTTTCCACGTCCGCACCTAT
TTTTTCCAACGACGATGAGCGAAGTCGTGCCGAGCAGCTGTTCTTGTCGCTTTTAGCCCATTTTTCGGCACCCGACATTT
CTCATGAGCATGTAGAGCTTCGTACGCCGTATCTACGACTTGAGATGCTGCGGCTATTGGCCGCTCCAAAGATCTGTTTC
TGCGTGCGTTTTTCGCGAATATGTCGATAGTAGCACGGCCACCATCCAACAGGTCCATCTAACTCTGCTGCCGGCTAAAA
TCGTGGCTTTTTCCGACTTTCTAGTGGCAAATTTCTTCCTACCTCGTACGAAATGTTCTTTACCCATTGATCAGGAAGCA
TTTATATACTGACGTTCACGTATAGTCAAAGCGGTGTCCGGCAAGACACCACAAGCTATACCCGGCTCTCTTCAGATCCC
GGACACAGAAGCTCACCGGGTGTTATCAGGCCCACAGGTACGGCTCAAGGCGTTGCGTCGTAGCTGTCTAATTCGGGATA
GACACCGTTGTGTTATAACACGGGCATTCGATATAAAAGAAGCCGAAGCGCGTGCTGGACGGGACGGCCTGAACGCGACA
GACGATGACGGGCAGCTCTTAGGCGAACAGGACGAGTTTGTCCGTGTTGACTTGGCTCATATCCTTCCACACTCACTGTT
AAATACGGAAGGCGATTCACCTTTGTTAGGTTTGATGCTTCCTTTACTTAAACCCGTTGCAACGCTTTTCATTAGCAACA
AGTCACGTTCTCACATATACATAGCACGTCGCACGCCTTAATGCCTTGGCAATTCTCGACATGTTCGATGTCGGTGTGCG
ACACCTAATCGAAGGACAAAACATCGATCGGCCGACAAATGCCATCACCCTTACACAAGAGTACCATGATAGATTTGGTG
ATTTTAAAACCGTCTTTGAGTCCACGGACCAGCCACACACATACCGCATCGAGTCCGTTGAAGATCGCTTACCAGTCCTT
CGTAGGCCTATGCAGCCGATTACGAGGACTCTCTTCCTGTCCGTTGCCCGAATTCTACGCATGTCTGGCGCCGGTGAATA
CTGTGACAGTGTACTACGGGACATGGACGATCCGGAGATTCTCAGTGATGGTACAACCAATCTGGGAGCACTTGTCAGTC
TGCGTCTGGGCGGATGGTGGAACGGAGTGGTAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62