GenePrediction:GLEAN_1201 Details

Name: GLEAN_1201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1304271..1310043 (+ strand)
Length: 5773
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1304271..1307308 (+ strand)
Length: 3038
Type: CDS
Source: GLEAN
Position: GCSC_173:1307581..1307662 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:1308111..1308920 (+ strand)
Length: 810
Type: CDS
Source: GLEAN
Position: GCSC_173:1308994..1309357 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_173:1309553..1310043 (+ strand)
Length: 491
>GLEAN_1201 class=GenePrediction position=GCSC_173:1304271..1310043 (+ strand)
ATGGCTCCTTTCTTGTCCTCCAGCAGGACGGCAAAGGCACCGAAATCGCCAAAGTCGCCTGGCCGCTCGCTCTTCGGCAA
GGCCCTACCTACGACGCCGTCGTTCAACCGGCTCTTCTCGTCATCGTCGTCGTCTGTGGCCGCCGCAGCCGCCGAGCAGC
CGGCACTGCCACCACTGCCGCCGCCCTCGTCCAACCTGCTGGACTCAGCAACATACTCGTTTGTACCATCTGCCCAGGTT
TCGGGCGCACCGCCAGCATCGGACTACTCAAACTATCCGGCCTACCCGTCCAGCGCCAACACAGCGGCCATTCGCGGTCC
ACAGCCACCCTATGCTCCGACCAGACGTCCGGTGCCGGGCATCAACATGAATTCAACCTCGGCTGCATCATTGGCTACTT
CTGTCTCGTCTGCCACGATGCCTCTGCCATCCTTTTCAAACCGACTGGCGTCCAAGCAGCTGCCGCCCCAGCCGCCTCAA
TTGCCCGCAGAGCAGCCACAGTCGCCGTCATTGTCGCCTGTCCGGGCCATCCGTCGCCGGCCTGTGGGCAGAGCTGCTTC
GGAGACCACTTCCACCTCGCAGACGGCAGCCATGACAGCGTCGCCTCCGCTCGCGTCTAGCTCCCCTGTGGCTGTGTCAA
CATCTCCACAGCTGCCGGACCTCCCCACCAGCTCCGTGTCGCTGCTCGGCCTGCCCGAGCTGCCTGCATTCACGTCGCTG
TCGGCGGACGTCGAGCCATCACGACAGCTGCCTCGTCAGCGCTCACCGCCACTGCCGTCGCAGCTGAAATCGCACCTCAT
CGCACCGTCGCCACCGCCCCGAGCAGCCTCTCCTGGCGGCGCCTCCATCTCGAGCATCCTGTCGGCCTACTCGCAGTCGT
CGCTTCATGCCGGGCAGTCGTCGGCATCCGAGGACACTGCGAACACCAATCACTCGTCCTATCTGGCTGGGCTGGCCCCC
AGTCTCAAGGGCACTGGCACAACCGGCCCCAAGGACGGGGACGACGGACTGACACCGCTCTCGTACCTCCTGGAAGAAGA
CTATGGCGAGGCCGAGGACGGCAGCGAGGTCACAGAAGAAGAATTATTTCGCCACTACGGCCAGTACGACCCTGAAGAGG
ACAGTCACGCGTCACTAGATGCTAGCAACGTCAGCACCACCATCGCACCACCGTCACCACTGCCCACTAAGAACGGCCAG
ACGGCGCAGCAGCAGCAGCAGGCACTGCCCCCCCGATCGACGTCTCTGCGCGACCCAGCTTTTGCGCCCGAGTCCGTGCC
ATCCTCTGACGACAGGACTTTACCGCCTCTGCCGGTCGGAGAAGCGTCTTTGAAGCCGTCGTTTAATGCGCCCACCGCTA
CAGCAACTACAGCACCTGCATCCGAGCTCTGGAAGCGCCGAATCGAAAATGCTGACGGGGCCCCATCTCTGCCTGAGCTC
GACCTGACCTTTGCGTCCACAGTGACGACGGCGTCCGGATCCACTTTTGCCAACAGCAACGCCGAGCAACAAAAACAGCT
GCCTTCCCGCCACCCACAGGGGCCCAGCACCCTTCGCAACCAGCCGGCCTTGCCGCCGCCGCTGTCGCCGCTCCCACCAC
CGCCTGCCCGCACAAACACAGACCAGCTGCACGCGCCGCCTCGTTCTCCCTTCCTCAGCGTCTCGCCTGCGGCTGTCGCC
GCGTCGTCGCCGCGGCCCGGATTGCCTGGGCGAGATATCAGGCCCTCCCGACAAGCAAGCCCGGCTGTGACGCCGACACC
GGTGTCTGTAAACTCGGCTTCGGCAGCACAGTCTCCGTTATCTCCGGAAACATCGTCGGAAGCATCAGCAACGCCGGTAG
AGCTCGTCGGCAGCCCCGCTCTCAATACCCCAAACAGTTCTGCCACCAGTCCTGTGTTCAGCTCCTTCTCCAAGATGGGC
CACTCATTCTCCAAATTTGAGGCCAAGGTCGAGAACAAGCTGAAGCGCAAAGACCCCAAGAATAGTGTCAGCGGCACTAA
GGCCGCAACAGTGCCTTCGCCGGCGAAAGATGTCTCGTCATCGCCCTCGCCCCAGCTGCCAGTACCAGCCAGTCAGCCGT
CGCTGTCGTCGGCGCCGCCCCTTCAGCGACTGCCCACCCCCGACTACGATGACGAGGAGGATCGCAGCAAGCACGCCCTT
TTCAACGGCACGGCTACAAATGGCGCGGTCATCGCCTCCAATGGCAGTGCCATTCCTGCGACATCTACGCCGCCTGTGTA
CGCACCCGCATCGCCGGCCACGTCGCCGACCGCATCGCCGGCATCCACGCTGGGTCTCGGCATTCTGCCACCACCGGCAC
CGTTTGCGCGGATGGACAGCGGACAGATCTCACCGAGGAGCAGTCCTCGGCCCGCAGCACAACCACAGTTTCGCTCTGCT
CTTCCCGGCCGTGATATTCGGCCTGCCAAGAATGTAAATGTGTCAACGGTGGCATCTCCTGGACAGACACAATCGCCGCA
GCCACAGCAATTTGCACCTCGGACTTCATCGCGAAAGGTGTCGTTTTCGACGCCATCACCTCGCGACCAGTTCCACTCTC
CCGACGACGCTTCCACCGTCAGCGAATCCAGCAGCCAGCTGACCATCAAGGCGATGCCACCGCCGATGCAGCAACCGCCG
TCGTCACCTTCCAAGCCGGGCATGCTTCCCGTGTTCCCGGTGGGCTACATGTCACCGATGGCACCCGGCACAGTGGTCGC
TGCCCCCCTACCGGGCCCGGTGCACTTCCTCTGCCTGCATCGGCACCGCGAAATGTTCCGCGACCGCAACACGTATCACC
CACTCAGCTGTCAAGCGTGCCAGACGCCGGACCGCTCGGTGCGATGGCGGTGCAAGTGGTGCTGTCTGCGCGTATGCACA
AGTTGCCAGGCCGCACTGCAGAGCGAGGCAATAAGTGGCGATCTGGAGCGGCTGATGGCGCAGCTGGCACAGAGGGGCAG
CGGTGGCGGAATGGAGCCGTATGGCTCGATAGGGCAGGGATCCCCGCTGGCCTACGAGCTGCCGGCGATCCAAGAGGCGT
GATTTGATGAACGATTTATCTTGATGCCTTCCTTGGCTTCTTTCTACTGCAGGGGGATGAGGGGTGTGGTTTTTGCACAT
CTTTGGTTACGATTTCGAGGATGTGCTTTCTAACGAGACGGCGTCTTTTGAGGCTGATACAAAAGGAGTTGCGAACGGTC
ATATACACATACAAGGGGGTAATAACACAATATGTACTTGGGATAGTAGTTTGTAGTATGGTTTGTTTCTGAGATTTCTT
TCGATCTGGTATAATACACACGCTATACAGAAACGACGTGGACAGCATCACGCCAGCAAGGCGGACACGAGCGCTGCTAT
CATTGGCGGAAGGTGGTCGCAAATGGGCCAAGGTGCGTGCTGCAGCAGCCCAAGCGGACACGACAGGACTCCGCAGGCAG
CATTGGGCATTGCGAAACGGTCTGCGTTTTGTGTCATTCTACGGAGTAGGAATCCTCATTCCTCCAAGAGCAGGAGCGCG
TGACGGAGCTTCCTGCAACTACGACGTAGCCGGCAGGCACGCGGTCGCGCGTTGCAAGGCTGCACCTGCCGCGGTGGAGA
GCCTGGCGTCTTAGGGCGCTGGGGTCGCTTAGTGCTCCGCTAAGCCCCTGGGGCCAGCTCACCGCCCTGGAACAAGACAG
AGCTCTCGTTGTACTTATTTTCGGCCATAGACCGATTGGTCTGGTAAGATAATCGATCGAAGTGGTAATCTTCGTGTTAC
GACACAACAATACGGCCAGGCCGAGCAAAAAAAAGAAGCAGACAAAGGACAGCCGAGCGAGCACAAGACCAGCGCCACAG
AATGTCTTCGCCGAAGCCGCCGCCAGCGTCACCAGCGCCGACGAGTCTGGCCCGGACGCGATCGCTGCGGAGGCCCCAAA
TCGGCGTGTCGGCCGTCGGCTCATCGATGGCGCAGCCGGGCGTGGCAGCACGCAGGCTGCCGTCGCCGAGCAAGCAGTTG
CCGACGATGAGCACACGGATTGGCTCAGGCGTGATGCCCGGGCGGCTACGACGGACAGCGACAGTCTCGGCCTCGACAAC
GACAAAGGCCAACACGTCGCCGACCCGAGCAGCACCAGCAAGGTCCCTGTCGACCAGGATGACGGCAGCATCGTCATCCT
CGACATCTTCGTCGACCTCCTCCCGCTACTATCCGCCCTCGTCTTCGTCTGCGCTGCGGCGTCCCAGCTCGTCCGACGAA
CCGCCGTCTCCCACCAGAGCCTCGTCCGGTCCAGCCGTTCCGCATGGCCGGCTACTACGGACAGCCACACTGCCGGCACC
CCGAAGTCCCGGCAGTACCGGCTCAAGCGGCGGCTACCAAGGCCGCACCCGATCGACCACGATCACTCGGGGACCGTCGC
CGCTGTCGACCGTGTCCACGACAGCAACGCTGACGAGCAGGACGAGCAGACCGGCCAAGACGACTTCTTCGGCCACCGCC
CTGACAGCAGCCATAGTCCTGCGGCCACCCTCGGCCGAGTCGTCCTCGGCCAGCAGCTCGACCACGACGGCCACGACGAC
AACCAGTGCCAACAAGAAGAGCCGGACGACGCCGCCTGCCTCGTTGCACCGTCGACAACGGTCTGCCACGATCGGCAGCA
CGTTGGCCCCGTCCGTTTTGGCCTCCGGCTCTGGCTCTGGCTCGACATCGTCGTCCCGTCCGGCTTTTTCCACCCTGCAG
CAGCACTACTCGCCAGCCAAGTCACTGGTACCCAAGCCGCGCACAGCCGCCATCTTGGCGCCGCCATCGCCCTCCAAACG
ACCGGCCAACGTGGCTCTCTCGGCCGAGACGGCACGGCTGCAGACGGTCCTGTTGCAGCTGCACCTGTTGCACCGCGACT
CGGCTGCCACGACTGCAGCCTGGCACGCGTCCGCCCGCGAGCTGCTGGGCCGTCGATTCGCCATGCTGGCTGCCGCTGAC
ATAGAGCTCGCACGCGCCGCTGCCGTACAGGTGGAACGGGCCAATGCGGCGGCGCTGCAGCGGTGGAAAGGCGGCGGCAT
CCACACGCTCGACGAGAACGTACAAGCGCTGGACGAGGTGCTAGCTGGTGTTTGGTCATTGGCAGTAGGAGCCGGCATGG
TCGATAGCAGTGACCACCACTACCACAACAACAACAGCAACAGTAGCAGCAGCAACAGCAGCAGCAACCGGTATGGACGG
GTGGTGCGACGGTTTGAGCGATGGGCCGAGCGAACAGCAGCACTAGTAGAAGCACGTCGACAGGCGGTCAAGAACCTCGA
AGAGGGTGATGAGAGCGAGGACGATGAGGACGATGACGAGGACGGGTCGAGTCTTCTTCTCCTTCTTCCGGGCGAAAGCC
ATAAGGACCCGGCGCTGGTGCTGGATGCAGCGTGGCATGCAGACTGCGCCAACCTGACACGCAAGCTGGAGGGATGGCAG
CGACAGCTCGATATACTTGGCGATGGAAATATGAATGGTGGAGGTAAAGGGGATGGTGATGGTCTTGATGGTGGTGGTAC
GTCCAGTCTCGATAGGATTTTGGGTGGCTGCCGCAGGCTCGTGGACGACATGCTGGCAGAGCTGAACGTGATGCAGCAGC
TTGAGCGGGACGCAGCTGAACAGGAGCTGGCATGGATCCGGCGCATGAACTCGGCTCTGGACGGCCGCGAAAGCACATCG
CGGCAGCTCAGCGACAGCATCAGCAGCATTGGCAGCATTGACAGCATCGGCTGGGCAGCACCGCGAGCCGGTGCCATCTG
GCGGGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62