GenePrediction:GLEAN_1202 Details

Name: GLEAN_1202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1312992..1316531 (+ strand)
Length: 3540
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1312992..1314204 (+ strand)
Length: 1213
Type: CDS
Source: GLEAN
Position: GCSC_173:1314276..1314971 (+ strand)
Length: 696
Type: CDS
Source: GLEAN
Position: GCSC_173:1315033..1316531 (+ strand)
Length: 1499
>GLEAN_1202 class=GenePrediction position=GCSC_173:1312992..1316531 (+ strand)
ATGGACGGCCCGGAGACCGGCCTCGTCCGCTGGTCGCCCAATGCGGGCGTGGACTCGTTTCTGCACATCAACCTGCAGCA
CCGGATTGTGCAGTTGTACGTGCCGACGGGCTACGCCAAGACCGGCCGGTTCGAGTACCGCAACTTATCGAAGCACGAAG
ACTTTCCGACGCTGACGTCGTTTGACTGGGCGCCCAACATCCCCGGGCTTGTGGCCGTGGGCACGCCGACCGGTGTGGTC
AACCTGCTCAAGATCGACGACAACTCCAACGCGTACATGGAGCTGGGCCTCAAGATGTCGCGCACGTGTCAAGCGGTCTC
GTTCAGCACGGCCAACCGTCTGGCCGTCGGGCTGGACCGCGTGCGCAGCGACCGGTGTCTGCACATCTGGGACGTCAACC
GTCTGGTGCAGTCGTCTTCGCGCGGACAGGACGGCGTCGGCTTTGCCCGGGATGTCGAGCCGTTTGGCGAGCCGGTCGAG
GTGCGCGAGCCGAGCGTGTCGGTGTCGAGCGTGCGCTTCTTCGAAGACAACCCGAACACGCTCGTGGTCGGGATCAAGGG
CCAAGGGCTGCGCATTCATGACTTGCGCGACCATAGCGTGCAGATGCCCAGTTTCCAGACGCGCTGCAACAACAACCTGG
CCATTGACTATGCGGACCCCAACTACTTTGCCTCGTCCGCGCTCGACAACCCGGGCATCATGATCTGGGACCGGCGCGCG
GGCAACCGGGCGATGGCGTCGCCGCAATATCTAGACGCCGTCGACGTGGACGAGCTGTCGTGGGGTGGTGCCCTGTGGCT
AGACAGGGCCGTGTCGTCTGAGTCGGAGCAGGCGATGAGCGAGAGCAAGAGCTCGGTGATCCGGTCGCTGCGGTACTGCC
GGGACCATCGCGGCATGCTGGGTGTGCTCTCGGGGACCGGGCAGCTCAAGGTGTACGAGACGGTACACGAATACTGCTCG
CTAGACATGGTGGCCGACCGCAGCCCTGAGCTGCTGGAGGTGCGGCGGACCAACGAGATGGACAACCAGTACTCGGATCC
GAAGCGAAAGAGCGAACGCATCGTGTCGTTTGACTTTGTGACCATCGGGTCGCCGGCACTGCGGCCACGCGTGTTGGTGC
TGCGGTCCAACGGCAGCTTTGGCATTGTCGAGAAGCCGTCGTTCACGGCCGAGTACCCGTTCAAGCTGATTCCCTGGACG
GCACCCTATCGTGGTCTGGAAGGTATGTGTGTGTATATGTATGTGTGTGTATGTGCATACAGCAGCAAGCTGACCCCCGA
ACAGAAGGCTCCTCGTACCACAGCATGATGCAGCTGGAGATGGACCAGGCGGCCGAGATCCTCGGGCCGATAGCGCTAGA
GGAGGCGCTTGCAGACATTCCCATCTTTGCGGCGGATGCGTCAGCGATCGAGGCAGCGACGCAGACGGCCCAAAAAGCAC
GCGCCGCCCAGCTGAGCGGGTTGGAGACGACGGCGACAACGACAACAACGACAGGCGACACGGTCAGCGAATTGAGGACG
CCACCGGCCAAGCTTCCGGATGAGTTCTATGCGGCGACGACGGTGGCACAGAAGCTCAAGATCTTGCGAGCATACTCGAA
GCGCCATCTGCGACCACAGCAGAGCAAAAAAGGGGGGCCAGCGGTCTCGACAACGACAGCAGCAGCAGCAGCAGCAGCAG
CGACGACGACGGCAGCCGAAGCAGTGACGACGTTCTCGGGCCGAGCTGACCTGACAGAGTCGACAGCATCACTGGCATCG
CTAGCATCGCTGTCAGGACGGCCGCTGACCAGCCAAGAGCTGCATGAGAGCCTGCTGAGCGCAACGTTGGTGCGACAAGG
GTTTCCATCGGAGGCACAAGTAGTGCTAGACCACGTAATGCTTCTGCGAGCCAAGGAGCGGTATCTGTTTGACAGCGAGG
TGAATCAGGTGGTGGTGGCCGACGACCCGTGGCTGCGCGATGTGTGGAGGTGGATTGGAGGTGAGTGAGGGAGTCGGAAG
AGTTGACTTGACTCGATCTGACGGTAGGCTAACGAAACCAGACGCAGAAGCTGCGGCCAAGAGCGGCGGGATGGTGGCAC
ATTCGCTGGACCTGTCGTTTATGGGCGTGGGCAGCATCTGGCTGGAGGATCTGGGGGTCAAGAAAGAGACACGGATCATC
AGTTCGGAGCCGCTGCCGGCGTCGTTTCCGGAAGCGGGAAACTGGCAGCGGGCGATAGCGGCAATCTGCCGGCGCCGAGG
ATTGCCGCCGTATGACGGGGTGGAAACACGACGGCCACACCACCGGCAGCTTTGTCTGGAGATCTGCGGCTGGGGTCGGC
CACCAAACAACAAAAGCGACGAGACGGGCGAGCGAGCGGCGTCTTTCCACACGATGGCAGCAGCGCAGGCGCTGTTCCGG
GGCGACAGCCAGCAGGCGGTGCGGATTCTCAAGATGGCCAGCGGCGAGCACCCGGAGCTGCTGTTTGTGTCGCTAGCACT
GCAGCTGATGGAGCGGGGCGGCGAGTCGGATGGCGCGGGAGGGCGGCTGCTAGACTTTGACGAAGCGCTGGCATCCAAGA
CGGATCCATACCTGCGGGCGATCTCGTCACTGATCGCAACGGGCGGCGACTGGATGACGATTGCACACCAGACATCGCTG
CCGCTGCGAGAACGGGTGGCAGTGGCGGTGCGGACGTTTGACGACGGCCAGCTGACGGCCTGGCTGCGAGAAACGCGGGT
GGAAGCGGTGCGGACGGGCGACGTGGAGGGTGTGGTGCTGACGGGGCTGACAGACGCAGGCGTGGACATCTGGGCGCGCT
ATGTCGACCGGTTCCACGACGTGCAGACGGCTGCCTTGGTGACAGCCCTAGCAGCTCCGCGATACATTGACGATGTGCGG
TGTGCAGCGTGGCGACGGGCTTACGGGGCGTATTTGCAGCGGCACCGGGCCTTTTTCCAGCGGGCCAAGTTCGAGGTCGA
GAGCACCAAGCGCAGCAAAGGCACGGCCGACGGCCGGCCGCGTCTGGTGCCACCAGCTCGCCAGATTGCGCTGCGATGTG
TCTATTGTGATGCCCAGACGCGACTGGCCGGTGCCGGTGGTCCTGGCAGTGTTGGCGGCGTGACTGGCGGCGCCGGTGGA
CCAGGTGGTGTGGCCCCTGCCGGTGCTGCCGTCGTGGTGATGCCGGCTGGTGGTGGAGGTGGCAGTGGCAGCGGCGTTTC
AACCGGTTCTGTGGCCTCATCAGCACCTCCCGAGGCCAACAATCAGCTGCGGGCCAAGCTGGTGACGGCCGGCATCAGCT
GTCCCAACTGCAAGCGTCATCTGCCGCGCTGCGTCGTCTGCCTCGAGATCGTCGGCACGCCGCGGTCAGATCGTCCGGAG
ACGTCGGCCGATGCAGACACTCGGTTGACGGCCCAGTTCCCGACTTTTTGTCTGCAGTGCGACCACGTCCTGCACTTGGA
TCACGCCCGCCAGTGGTTCGCTCGCCATGCCGAGTGTCCGGTGCCGGAGTGTCGCTGTCGGTGCAATTTCCGGGCGAATC
CTGAGCTGAACTATGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62