GenePrediction:GLEAN_1204 Details

Name: GLEAN_1204
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1340715..1343479 (+ strand)
Length: 2765
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1340715..1340864 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_173:1340912..1341723 (+ strand)
Length: 812
Type: CDS
Source: GLEAN
Position: GCSC_173:1341779..1341921 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_173:1341978..1342843 (+ strand)
Length: 866
Type: CDS
Source: GLEAN
Position: GCSC_173:1343054..1343479 (+ strand)
Length: 426
>GLEAN_1204 class=GenePrediction position=GCSC_173:1340715..1343479 (+ strand)
ATGAGAATTGAACAGAGAGCTCACCTCGACAGACAGCGATGGATCGAGACAGCCGGCAGCAGTGCCAGCATTGCAGCCCT
GCAGCGGGCGGTGCGACAGGGCGGACCTGGCACTCCGTGTGAGGCCGGCCTGCGGTCTGTGTGCTGGAAGGTATGTTTTT
GGTTCTACGCATCCACTTCCACTGCTGACCGCCGCAGATCTTCCTCCTCTTCCGCGACGCGCTGCCATCGGACCGGCTGC
CGATGCTGCGGCGGGCCAGGACCGACTACGACGTCCTCGGCGAGCGGTACCTGCAGTACATCAAGCATCCCGAGCGGCTG
GCCGAGCTCGCCGTTGATCCGCTGGCCGATGACCCCGAGTCGCCCTGGGACACGTTCCGGCGCGACGATGTGGTCCGCGG
CGAGATCCTCCAGGATGTCCGTCGCCTGCCGGACGAGCCGTTCTACCACCAGGACCACATCCAAACCCTCATCCTCGACG
TGCTGTTCGTCTGGTGCTGCCACCACCCGCGCGCCGGCGGCTATCGCCAGGGCATGCACGAGCTGCTGGCGCCCATCGTC
TACGTGCTCGGCCAGGACGCCGTCGACGTGGCCGCTGCCGAGGCCGAAACGTGTCCCGAAGACGCCTCTATGATGGCCAT
GCTGGACGTGTGTTATCTGGCCCACGACGCCTACGCCCTCTTCTCGGCCATCATGGACAAGGCCCAGGCCTTTTATGAAG
TCAGCTCCGGTGGATCTGCCAGACGCAGTAGTAGCAGCAGCAGCAACAGCAACAGCAACAGCAACAGGAGCAGCAGCAGC
AGCAGCAATAAGAACAAGGGCAAGATCGCCCCCCTCCGAGACGCCCTCTATGCCTCACCCGTTTCTCTCAGTCCATCTGC
CGGCGTCGTCGAGCAGAGCGCCATCGTCGAGATGAGCCGGGCCATCCACGAGGGCACGCTCATGAAGATCGACCCCGAGC
TAGCCGTTCACCTCAAGGAAATTGAGGTCCTGCCGCAGATCTTCCTCATGTACGTGTCCGCTCGCTCTTTCTTCTGGCCG
GCCCGCTTCTGACGCCGCCAACAGTCGCTGGATCCGCCTGCTGTTCGGGCGCGAGTTCCCCTCTGATCAGCACCTTGTCC
TCTGGGACGGCATCTTTGCCTTTGACCCCGATCTGGACCTCGTGCCGCTCATCTGCGTGGCCATGCTGCTGCGCATCCGC
TGGGAGCGTACGTTCAGGGTGGGCGACTTTCTCTTTTTGATTAGTAAGCACTGACAAAGCTAGTGCTGGAGGCGGACTAT
TCTGTGGCTCTGCCGCTGCTGCTCAAGTATCCGCCGCCGGGGCCGCCTTACGGGCCGCACACCTTTGTCGACGACGCGCT
CTTTCTGCGGGACCACGGCGATGTTGAGGGCGGTGCCAGCCTGGTGCTCAAGTACACCGGACGGGCGCCAGCGAGACAGC
AGCAGCCGCAGCCGCAGCCGACGACGCCGACGACGCCGACGATGACGACGACGATGAGCGGGCACTCGAGGGCGTCTTCG
GCTCCCGGCACGCGCGTCGCGGCTGGGAGCAGCGGCACGCCGCGGACATCGACGCCCGGCGCGGGCTTTGCGGCCGGCCT
GGACAGCCTGCGGCAGCGGACGCGAATGGCGGTGCGGTCGCCTCTGCGGGCGCTGAGCCCAGAGGGGGGCCAAGGACAGC
CGCTGGCGCCCGGTCGTGAGAGCGTGGGCGCGCTGCTGCACGGTGCGGCCAAGGGGGCCAAGGGCGTGATGGAGCGCGGC
GAGAAGCTGGGCCTTAACCAGGCGGTGCGCGACGCTGTCGGCGAGATCCGACGGAACATGATTCAGGGGCTACAGGAGGC
CCGACAGGTGACCAAGGGGGTCGGAGGAAGAGCCGGTGGTGGCGGTGTCATTGACAAGGGGACAGACCCGACCGGTCAGG
TGCTGCAGGTGCTGGCCGAGATGGAGCGGATGGAACAGCGGAACCGACAGCTGGCCGTGATGCTGGACGAGACGGTCGAG
TCGCTGCGGTCGCTGGTGACAGGCGAGGCAGGCGAGGCGGGCGATACAGACGAGACGACCGAGAGCCAGAGACAAAGCCC
GTGGCTGGACGTCGTCGAGCTGGCCGCGGCAAAGGTGCAGTTTGTCAAGGTACACCTCGAGGACGGCAGCCTGGCCCTGC
CGCTGGACGAGGAGCCGGTCGAGGTCGAGAGGGAGGACAGAGATGAGACGGCCGAGAAGGAGGACAAGGTTGAGAAGGCA
GAGGAAGAGGACAAGGTCGAGACGGTCGAGACAGTCGAGAAGGAAGAGAAGGCTCCCAAGACCGACAGTCCAGCCGAAGA
GCCGACAGGCTCTCTACAGACGGAGCAGCAGCCGCCACGAGAGACGCTCCCGCCTGCCGCCATCCCGTCCTCCATCCCCA
GTCGTGCCACGCTGGCCCAGTCGTCCTTTGCCTGGATGCTCGAGCCCGAGGACACGCCGACCGGCAACAGCAGCGACGGT
TCCGCCTCGGCCAGCAGCCCCGACGGCAGCACATCCAAGAGGCGGGCACCGCGTGCCAGTCCGGTCGGCCGCGGCCGACA
TGCCTTTCTGTTTGGCGACGTCGTTGGCGCATCGCCGCTGGTAGGAGGAGACGTCGGCAGAGACCGAGACACAGACCCGG
CCAGCGGCAACGGCAACGGCAACGGCAATGACAGCTCAACCACAGCAGCCGGCGCACGGAAACGGTCGGCCGGCTCGGCA
GACGAGATCTTTGGGCTGGAACCGCTGCGGCGTGTCGTGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62