GenePrediction:GLEAN_1205 Details

Name: GLEAN_1205
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1348338..1352624 (+ strand)
Length: 4287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1348338..1348371 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_173:1348427..1352305 (+ strand)
Length: 3879
Type: CDS
Source: GLEAN
Position: GCSC_173:1352359..1352624 (+ strand)
Length: 266
>GLEAN_1205 class=GenePrediction position=GCSC_173:1348338..1352624 (+ strand)
ATGCTCCATATTTACGAGGAGGATCCGGAGTCTGGTATGAGCCCCCGCCCCCGCCTTGCTTATCCATTCTTGTTCACACC
CTCTGCTAGATGCCAACGATTATCGCCATGGGACAAGCCAGGATGGCCAGCTCGGTCGTGACAGCAGCAGCCAGCTCAGC
CTTTCTCTGCACCTACCCAAGAACCGCAGCACCGGCAATCTCGCCTTACCTGTCGATACCCCGGCCAAGGCTCGCTTCCG
ACTCTCCTTTGATGCTGGCGCAGCTGCTGCCGATTACGACGCCATGGCTCAGTATGCCCACAGCCACTGGCTGCTCCCTG
TCTTTTTGTCTCCCGCCTCTCTGCTAACCTTCACTATCAACAGCTCTCCCATCATGACCGACCATGATCATGGCTTGGGC
CGCTCTGGCCTTCGCCGTATCCGTCAACACGTCCCTATGCGAGCCCCAACCCTTCCGTCCAGCGCGTCTTCTCGTGCGTC
GTCCATTGGCCTGCCTCGTTCCTCCTCCATGACTACGATGCTCCAAAGTTCGCGCACCCTCTCTCCGAAGCCTTCCTGTC
CGGCCTTCACGACGGCCTTCACGGAAGACCTGTCCCGCTTCTCGTCCGAGTCCCTGCACTCCTTCAGCTTCGCTCACCAG
TCCGAGGAGCTATTGCACAACCGCCAAAGCGTCCTCAAGCGCTCCGTCGAGTTTATGCAGGACCGCATGGGTTGGCCGGC
CAGCTCCAATGCTGGTCTGGCCAGTGCCCAAGCCCGCGCCTCCGGCGACCTCGAGACCCAGAATATGCTCGACCTCTTGG
CGCGTGCCCAGCTTGTCGGTGCCGGCAACTTGCCCAATTCGGATCCAAACATGATCATAGGGCCCTTGAGTGGACCGCCC
TCGCTGACAAACGAAAACGTCTTCGACAAGAGCTTTATTCCCCGGACTGCCAGCCCAGAGCAGCTTTCTGGATCGGAAAC
AGCACCGAACTCTGCCTTGCCGTCCCCTGTGCTCTTGAGGACGACGGCCTTTGCGGACAACTCTGTTTCCCCGCTGCAAG
GCAGTCCCGTCGCCAGTCCCGTCATCAGCCCCAGCAGCGGCGGTGGCCTGCAAGTGGCCGCGAATCAGACCTCTGGCCCT
TCCGTATATACTGCCTCTGCGGCCTCAGACTCGGCCGAATCTTCGCGCACGCCAACAAATGAAAGCGGCACTACGCAGAA
GACGTCCCCACCTGCCTCTCGGCACCCGAGTCTTTTGCTCAGGCGGTCCATGACAGACATTGCACCTGTTGTCGTGCAGC
AGAGGTTGATAGACACACTGGCCAGGTCATATGTCCCTGGCTCGGTGGAAGCACAAACGACTGCAAACTACGGCGTGCTA
GCGACCCCTGGTGAGAATCCATATGACTTGGCGAGCTCTCCCCATGCATCTCTCCAGCCGCTGGCTTCTCCACTGAGCAT
GCCTGGAAATCTGGGGTCGGCGGTCCATTCACACACCTCGCGCTGGGTGCCCGCAGCACAGGCCATCTTCACTACCGAGG
CGAAGCCGCCATGGACGATCATTGCGGCCAACGACCTTGCGTGTCTTGTATTTGGAGTGACAAAGGCAGAGGTCCGTAAG
ATGGGCATTCTGGAGGTCGTCCAGGAAGAGCGGCGAGCCTGGCTGGAGAAAAAGCTGCTGCATGCCGATCCTGACGATCC
TGGCGATCTTGGTGATCCCGGCGAAGACATCGCCGGGATCAAGGATGAGGGCGATGGTATGTTGACCGAACAACGGTCAT
CAGCCAGCTCCTCGATTAGCATACTTGGATCTCGTGGAGGCGGTATTACAGCAAAGCTCTTGAGCAAGCCGAACTCCCGG
ACACAAACTCCACAAGGCAGCAGCCAGCACCGGCTCCTATCTCTACAAGGCAAAGAGCAACAACGGTTACTGCAGGCCCG
CCGTGCAAACACTATACACGGCGGTGAACCGAAGCCGCCCAAACCGGCCGGTAGCAGCCACCATCACCACACCAACTCGC
GTGGCGTTCTCCTCTGTGGTGATGTCGTGCCCATCCAGAAGCGCAACGGGGCAACCGGCTCGGCCAGTCTCTGGGTGAAG
GAGAAGCGCATCGGCCTGATCTGGGTCCTTGAAGAGATCCACGAGGACGTGGCCACGGTCGTGGTCGACGACGACGGCAG
TGTCGTCGACGTCAACGGGTCCCTCGGCTCGATCTGGGGCGACGAGACAATGCAGCCCGGCGTGGACATTGGCAAGCTGG
TGCCTCGTATCCCGCGGCTAGGCTTCGACACATGGTCTGGCCCAGTTGATTTTGCCGAGGTTGAACGGCGCAAATACTAT
ACCTGTCGCAACTGCGACCGCATCAACATCCCAGCCACAGTCGAGCGCGTGTCCGGCCAGTCGGCGCTGCGCATCTCCAG
CTTCCCGCACATTGCGGGTATCATTGTGGTGTCGACCAAGACGTTGGCTATCAGGAGCTCAAATTCGGTCTTTGCCGGCG
CTCTGTTTGGCTACGAGATGCTCAACGGTTACCCCATCAACCAGTTGATCCCAGACTTCGACAAGATTCTGCAGATCCTC
ACCGATGTAGACAACATCCACTTGGTTGATGGCATGGTGGTCCCGGAGCACAGCTTTCGAAAGGCGTCGGCATTCCTGGC
CCTGCGCGAAGGACGACCCGATGCTAGCACGGCCTTTTTGCGCCCCGAGGGCCTGCCGGCACACCACCGGGACGGCTCCG
AACTAAAGATTGACGTGCAGATGCGAGTTGTCAAGAGCGAAAAGCGGACGCGAATTCACGAGGAGACGGTGGTGGAGGAA
GATGAAGAAAACGAGGAAGACGAGTCTACAACCGCGTCGTCCTCCCTTACCGGCGATTCCGCCCAAACCTCATTCACAGT
GTCTCAGTCAGAGATGGTGTACGCCCTATGGATCACGTACTCGCGACACCTGCATGCGACGCGGCAGAACCTGGGCATCG
CCTCGCCGTTGTTGTCGGGCTTTGCCACTCCGTTGCATCAGCCATCGCCTGGACAAACGCCGAACCACTCACCGACCGAA
ATGATGTCACCCCAGACGACGATTGACCGACGCCTGCAGATGTCACCGCGGAGCTTTGGCGAGCAAAAATCAGTGGCGCA
GGCGCTGACTCGCCAACTGGAGGATGTGGCGATGAAAACGGCCCGGGAAGGCGACCAGCCAGGCACGATGCCGTCGATCC
TATCACAGATGTCGGTGCAGGGTGCGACACCGAAGGCTACGGTGGTGGCGGCAGCAGCAGGGTCGATGCCAGCTTTGCCT
TTGCCAGGCGCGACGGCGAAGACAAAGACGGCAACCAGCCAGTCATCCGCCAGCACGGCAACAATTGTGCCCACTGCATC
CGCTTCTGCGATGGCGACCACAATGACAACCGCGACCACGGGCCCCGGATCGACAGGGTCAGAGCACAAGAAGACGATTG
ACGACTTTACTATTGTCGAGGAGATGGGGCAGGGCGCGTATGGTCAGGTGAAGCTGGCCAGATACAAGTCGACAGGCAAG
AAGGTGATTATCAAGTACGTGACAAAGCGGCGCATCCTGGTGGATACCTGGACACGTGACCGGCGGCTGGGCACAGTACC
GCTGGAGATCCACGTGCTCGACTACCTGCGACGAGACGGGCTGCAGCATCCCAACATCGTGGAGATGGAGGATTTTTTCG
AGGACGATGTGAACTACTACATCGAGATGGTGCCCCACGGGCTGCCAGGCATGGACTTGTTCGACTACATTGAGCTGCGG
CGCAACATGGAGGAATCAGAGTGCCAGTGCATCTTTGTGCAGGTGGCCCAGGCGATCCACCACCTGCACACAAAGGCGAT
GGTGGTGCACCGGGACATCAAGGACGAGAACGTGGTCTTGGACGGAGACGGCCACATTCGGCTGATTGACTTTGGTAGCG
CGGCCTATATCAAGAGCGGGCCGTTTGACGTCTTTGTGGGGACAATCGGTGAGTTTGCCAATCAGTACTGATATATCCAT
ATTCCTTTGCTGACTGATCAGACTATGCCGCTCCTGAAGTGCTTGCTGGCCGTCCGTACGGTGGCAAGGAACAGGACGTA
TGGGCGCTGGGGATCCTGCTGTACACGATCATCTACAAAGAGAACCCTTTCTACAGCATCGACGAGATCATGGACCGGGA
TCTGCGGGTGCCGTACACAATCAGCGACGACAGCATCGACCTGATTCGCCACATGCTAGACCGCGATGTGGCTCAGCGGT
ACTCCATTGTCCAAGTGTTGGATCATCCGTGGTGCCAGAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62