GenePrediction:GLEAN_120 Details

Name: GLEAN_120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:820052..821691 (+ strand)
Length: 1640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:820052..820060 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_179:820140..820670 (+ strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_179:820729..821275 (+ strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_179:821351..821691 (+ strand)
Length: 341
>GLEAN_120 class=GenePrediction position=GCSC_179:820052..821691 (+ strand)
ATGAGTGCAGTAAGTAACAGTAGCCGGTTATCAAGCATCCCCCAGATGCGTTTGCTGACCAGCCGTCTTCTTTCTTCCCT
ATGAGCAGCCAGCCTACAACTCGTCGGAGCCAGGCGGCGGCAACACGCTCGAGGTGGACGTGAACGCGCAGTATGCCGGC
TATGAGTTCAACTACACCTACCTCGTCTTCTGCGGCTTCATCGTCTGGCTCATCATCCCAGGTCTCGGCCTCTACTACGG
CGGCCTCGCCCGCCGCAAGTCAGCCGTGGCCCTGCTCTTCCAGTCGCTTATGGTCGCCGCTGTCACCACCTTCCAATGGA
TGTTCTGGGGCTACTCGCTGGCATACAGCCGCACTGCTGGCCCCTTTATCGGTGACCTGGCCAACTTTGGCATGAAGCAC
GTCATGGCTGCGCCGTCCATCGGCAACAACACGATCCCCGAGATCGTCTTCTGCCTCTACCAGCTGCTCTTCTGCGCCTG
CACCGTGCAGATCGTCGTCGGTGGTGCCTTTGAGCGCGGCCGCATCATCCCCTCGCTCATCTTCGGCTTCTGGTGGGCCA
CTGTGGTCTACTGCCCCATCGCCTGCTGGACCTGGAACCCGAACGGCTGGCTCTATAAGGTGCGTCGCCTCTTCTGCAAT
GTTGCATCCATATTGCATCCATGCTCACATCCTCTAGCTGCCCTCGCTCGACTTTGCTGGCGGCGGTCCCGTCCACATCT
CGTCCGGATGGTCCGCACTGGCCTATGCCCTCGTCCTCGGCAAGCGAAGGAGAAGCCCCGACGACAAGTACTTTGGACGG
CCGCACAACACCAGCCTCGTCTTTCTCGGCACTGTCCTCATCTGGTTCGGCTGGTTCGGCTTCAACGGCGGCTCCGCGCT
CAACGGCTCTATCCGCTCCATGCTCGCTGCCTTCAACACGAACACGGCCGCCTCGACTGGTGCCATCGGCTGGGCCATGG
TCGATTACATCAAGAAGCGCCGCTTCAGCGTTGTCGGCGCCTGCTCTGGTGCTATTGCCGGTTTGGTCGGCATCACGCCG
GCTGCTGGCTTCGTCGAGTGTTGGCTCGCTGCTGTGATTGGCTTCCTGACTGCCGTCGGCTGTGCTTTGGTCGAAGACAT
CAACAAATGGCTTCATATCGATGAGGGCCTGGACGTCTTCAAGCTTCACGGCATTGGCGGCATGCTGGGGTCCTTCTTCA
CCGGCATTTTCGCCACGCAGACAAGTAAGCCTATATTCCTACCCATCTCTTGTGCCGTCATTCAATCAGCCTCACAAATG
TGCTAACATCGGTGAACAGTATCTGCCCTAGATGGTGTCTCATATGTAAAGGGCGGAATCGACGGAAACGGGATCCAGGT
CGGCAAGCAGTTCGCTGAGATCACTGCTATTTCGGCATACTCCTTTGTCGTTTCCTATCTTCTTCTGATGATCCTGAAGT
ACATCCCTGGAATGCACCTGCGTGTATCTGACGAAGCCGAAGAGATGGGTCTGGACATGGACCAATTCTTCGAAGAGGAG
ATCGGTGACTGGGAGGTCTACGACAAGTATAAATCTCGCTTCGATGGACACGAAACCGTCGAGGGGCAAGCCATGTCCGA
CTCAATGGAACAGGTGGAGGTACCTACAAAAACAGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62